Home
JournalsCollections
For Authors For Reviewers For Editorial Board Members
Article Processing Charges Open Access
Ethics Advertising Policy
Editorial Policy Resource Center
Company Information Contact Us Membership Collaborators Partners
Publications > Journals > Gene Expression> Article Full Text
OPEN ACCESS

Transforming Growth Factor-β1-mediated Regulation of circ_DISP3 and ATF3 in Human Triple-negative Breast Cancer Cells

  • Sahithya Mohan#,
  • Ashok Bharathy#,
  • Magesh Induja,
  • Rushil Kolipaka,
  • Suryanarayanan Karthik,
  • Srinidhi Ganesamoorthi,
  • Kumar Sathiya,
  • Iyyappan Saranya,
  • Ravishkumar Lakshmi Akshaya and
  • Nagarajan Selvamurugan* 
Gene Expression   2023;22(4):297-305

doi: 10.14218/GE.2023.00101

Received:

Revised:

Accepted:

Published online:

 Author information

Citation: Mohan S, Bharathy A, Induja M, Kolipaka R, Karthik S, Ganesamoorthi S, et al. Transforming Growth Factor-β1-mediated Regulation of circ_DISP3 and ATF3 in Human Triple-negative Breast Cancer Cells. Gene Expr. 2023;22(4):297-305. doi: 10.14218/GE.2023.00101.

Abstract

Background and objectives

We previously reported that transforming growth factor-beta 1 (TGF-β1) promoted breast cancer progression and metastasis through inhibiting the expression of miR-4638-3p via directly targeting activating transcription factor 3 (ATF3). The present study aimed to elucidate the mechanisms of TGF-β1 downregulating ATF3 targeting miR-4638-3p via circRNA in MDA-MB231 cells.

Methods

Three triple-negative human breast cancer cells (MDA-MB231, MDA-MB468, and MDA-MB453) were employed. In-silico analyses were used to identify the list of circRNAs targeting miR-4638-3p. RT-qPCR was performed to determine the expression of shortlisted circRNAs. Transient transfection and western blot analyses were carried out to identify the functional role of circ_DISP3. A dual-luciferase reporter assay was used to identify the direct binding of circ_DISP3 and miR-4638-3p.

Results

There was an inverse correlation between the expression of circ_DISP3 and miR-4638-3p in these cells. Antisense oligos-mediated silencing of circ_DISP3 restored the function of miR-4638-3p, and downregulated ATF3 in MDA-MB231 cells. The luciferase reporter assay identified the direct binding of circ_DISP3 to miR-4638-3p in these cells.

Conclusions

TGF-β1 influences the expression of ATF3 to stimulate circ_DISP3 to sponge miR-4638-3p in hBC cells. Hence, we suggest that the circ_DISP3/miR-4638-3p/ATF3 axis regulated by TGF-β1 may have potential applications for bone-metastatic breast cancer.

Keywords

Breast cancer, Transforming growth factor-beta, circRNA, miRNA, Activating transcription factor 3

Introduction

According to recent statistics, breast cancer (BC) is the most common cause of death in women worldwide.1 Among the various BC subtypes, triple-negative breast cancer (TNBC) accounts for around 15% of all BC cases. TNBC is characterized by its aggressive histology, poor prognosis, shorter survival, and unresponsiveness to most therapies.2 Despite advances in the therapeutic field, TNBC shows an increased risk of early metastasis, causing high morbidity and mortality.3 Metastasis is a complex multistep process that starts with the invasion of a tumor from the primary site through the vasculature to a distant target site. The predominant sites of BC metastasis include bone, lung, and liver.4 The activation of several transcription factors and cytokines by the tumor microenvironment initiates metastasis to various organs.5 Such transcription factors are prevalent in BC, and one example is activating transcription factor-3 (ATF3).6,7

ATF3 is a stress-inducible gene belonging to the activating protein 1 family, whose expression is associated with multiple diseases ranging from cancer to cardiac hypertrophy.8 ATF3 has been implicated in regulating oncogenic activities through various mechanisms that either promote or suppress cancer progression depending on the cellular environment and the signaling pathways involved.9 ATF3 also plays an immunoregulatory role in the tumor microenvironment. For instance, reports provided by Chang et al. demonstrated that ATF3 promoted a microenvironment at tumor metastatic sites that aid monocyte recruitment and immunosuppression.10

Transforming growth factor-beta (TGF-β) is an essential pluripotent cytokine that regulates normal mammary gland development and breast carcinogenesis.11 Studies have implicated the regulatory role of TGF-β in exhibiting high percentages of lymphovascular invasion and lymph node invasion of micropapillary breast carcinoma.12 Studies have also shown that the multifunctional cytokine, TGF-β1, regulates the expression of ATF3 and promotes the growth and metastasis of BC.13,14 It was identified that genes for cell proliferation (cyclin A1), invasion (matrix metalloproteinase 13; MMP13), and bone metastasis (Runx2) were found to be ATF3 target genes.15–17 Therefore, targeting ATF3 may help control BC development and the ensuing bone metastases. Since ATF3 has few druggable sites like other transcription factors, direct targeting ATF3 for translational research is difficult.18

Increasing evidence suggests the involvement of noncoding RNAs (ncRNAs), such as microRNAs (miRNAs) and circular RNAs (circRNAs), in regulating BC pathogenesis.19–21 MiRNAs are small endogenous ncRNAs of 20–25 nucleotides in length. They regulate various biological processes, including angiogenesis, proliferation, migration, apoptosis, and differentiation, by binding to the complementary target mRNA.22 For instance, overexpression of miR-21 downregulated the expression of Leucine zipper transcription factor-like 1, a key tumor suppressor gene, in BALB/c nude mice, facilitating BC cell proliferation and metastasis to the lungs and liver.23 A study by Hunter et al. reported that the overexpression of miR-526b and miR655 positively regulates the angiogenesis of BC cells.24 CircRNAs are long noncoding RNAs (lncRNAs) with the characteristic feature of a covalent close-loop structure lacking 5′ and 3′ ends.25–28 There is emerging evidence of circRNAs that possess a miRNA response element (MRE) and function as competing endogenous RNAs (ceRNAs) that sponge and sequester the endogenous activity of miRNAs. For instance, a study by Sun et al. reported that upregulation of circRNA-0001361 increased the expression of FGFR4, a potential epithelial-to-mesenchymal transition and metastasis inducer, by sponging miR-491-5p.28 Silencing of this circRNA downregulated the expression of FGFR4, reducing the axillary response after neoadjuvant chemotherapy in BC. A study by Song et al. showed that the upregulation of circ_ATAD3B sponged miR-570-3p, which significantly increased the expression level of MX2, a gene linked to the progression of human cancer.27 circ_ATAD3B is currently being studied as a possible diagnostic biomarker of BC.

We previously reported that TGF-β1 promoted BC progression and metastasis via down-regulating the expression of miR-4638-3p, which directly targets ATF3 in hBC cells.18 Therefore, in this study, we aim to investigate the mechanism by which TGF-β1 regulates miR-4638-3p and ATF3 in hBC cells

Material and methods

Cell culture

Triple-negative human breast cancer cells (MDA-MB231, MDA-MB468, and MDA-MB453) were procured from the National Centre for Cell Science (Pune, India). The cells were maintained in Dulbecco’s modified eagle’s medium (Lonza Bioscience, Milan, Italy) supplemented with 10% fetal bovine serum and 1× antibiotics (penicillin, streptomycin, and amphotericin B) (Lonza Bioscience). The cells were treated with TGF-β1 (R&D Systems, Minneapolis, MN, USA) at a final concentration of 5 ng/mL for 1, 2, 4, 8, and 24 h).

In-silico analysis

A list of circRNAs predicted to target miR-4638-3p was retrieved from the cancer-specific CircRNA database (CSCD) 2.0 (http://gb.whu.edu.cn/CSCD2/#). The list was then sorted using filters such as circRNA present only in BC and MCF cells and seed sequence type (7mer-m8 and 8mer-1a). The validated circRNAs were eliminated from using TarBase and manual web search. A unique list of 10 unvalidated circRNAs was selected for further analysis (Table 1). The antisense oligonucleotide (ASO) for circ_DISP3 (5′-GGACAGGTCCCTTGGTACAGGTCGA-3′) was custom-designed and procured from Eurofins Genomics (Louisville, KY, USA).

Table 1

circRNAs that putatively target miR-4638-3p

S. nocircRNA IDScoreHost gene
1.chr12:11885925|11891342142ETV6
2.chr21:10454221|10499540144BAGE2
3.chr18:48962211|48965520154
4.chr3:12584517|12590905140RAF1
5.chr20:20391916|20392672145RALGAPA2
6.chr5:113082859|113143360154MCC
7.chr16:67280201|67280692150PLEKHG4
8.chr1:11530006|11530386142DISP3
9.chr7:99393741|99394320144AC004922.1
10.chr17:50862690|50863606160TOB1

Reverse-transcriptase quantitative polymerase chain reaction (RT-qPCR)

MDA-MB231, MDA-MB453, and MDA-MB468 cells were cultured and treated with 5 ng/mL TGF-β1 for 1, 2, 4, 8, or 24 h) or were not treated (control). RNA was isolated using Trizol reagent (Takara, Japan) and converted to cDNA using an iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA). qPCR) was performed with primers for circRNAs (Eurofins, Augsburg, Germany) (Table 2) using Genious 2× SYBR Green Fast qPCR Mix (ABclonal, Woburn, MA, USA) in Applied Biosystems QuantStudio 3 instrument (Thermo Fisher Scientific, Waltham, MA, USA). The relative expression of circRNAs was calculated using the ΔΔCt method, with RPL13AB as an internal control.

Table 2

Primers used in qPCR analysis of circRNAs

S. noNamePrimer, 5′– 3′
1circ_ETV6F: AAATCTCACAAAGTGCGGCAA
R: AGAGGAACCTGAACCCCTC
2chr18:48962211|48965520F: GACTCCCAGCTCTTGCTGT
R: GGACAACCCAGGAATGTGG
3circ_BAGE2F: AGGCTGGAAGTGAAGTGCAA
R: AGGAGCGCACTGTGTGTAAT
4circ_PLEKHG4F: GGGCCTTGGAGACCCTTTA
R: CTTCCCAGACTTCCCTAGC
5circ_TOB1F: CGCCTCCTTTTGGTCACTC
R: GGGAGAAGTACGTGCAACC
6circ_DISP3F: GGGGGTCCGGTTTTTCTTG
R: CCATTCCAGTCCCTCACAGG
7circ_RALGAPA2F: CTAGAGGTTTGCTCCACCC
R: CTGTGAGAACAAAGCCTGCG
8circ_RAF1F: CCCCAGAGGTGATCCGAAT
R: TAAGGAAGCTCCCCCGTCA
9circ_MccF: TAGACCGTCTGCAAGGCAC
R: CCTCGTTGACCTCGTGTTG
10circ_Ac004992.1F: GGCATGAGTATCTGGGATGT
R: GAGTGAAGGATGGGGGTCA

Transient transfection

Cells at 70–80% confluency were transiently transfected with negative control or antisense oligonucleotides (ASO) of circ_DISP3 (60 nM) (Eurofins Genomics) using X-treme gene transfection reagent (Roche, Basel, Switzerland). After 24 h transfection, cells were treated with TGF-β1 or left untreated. Protein samples were collected using RIPA buffer and subjected to western blotting.

Western blot assay

Total cell protein lysates were collected using RIPA buffer (Bio Basic; Markham, ON, Canada), comprising phosphatase and protease inhibitors, and western blotting was performed as previously described.29 Briefly, proteins were resolved by 10% sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE), transferred to polyvinylidene difluoride membranes, blocked, and incubated with antibodies. The protein bands were visualized using the Chemidoc system (Bio-Rad). The blots were stripped and probed. Antibodies against ATF3 (Cat #sc-81189; Santa Cruz Biotechnology, Dallas, TX, USA) and alpha tubulin (Cat #2125; Cell Signaling Technology, Danvers, MA, USA) were probed. alpha tubulin was used as an endogenous control.

Luciferase reporter assay

The luciferase reporter assay was performed using the pmirGLO Dual-Luciferase miRNA target expression vector (Promega, Fitchburg, WI, USA), as previously described.30,31 The sense and antisense oligonucleotides containing the wild-type or mutant MRE of the circ_DISP3 were synthesized. They were annealed and ligated into the pmirGLO vector. Cells were transfected with pCMV-MIR (empty vector; cat #PCMVMIR; Origene, Rockville, MD, USA) or pCMV-MIR4638 (mir-4638 overexpressing vector; cat #SC401776; Origene) along with the wild-type or mutant constructs of circ_DISP3 using the transfection reagent, Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). After 24 h transfection, the cells were lysed, and relative luciferase activity was calculated as the ratio of firefly to Renilla luciferase activity. Renilla luciferase activity was used as an internal control.

Statistical analysis

Experiments were conducted in triplicate, and the results were analyzed by one-way analysis. p-values of <0.05 were considered statistically significant.

Results

Identification of circRNAs that putatively target miR-4638-3p

The CSCD 2.0 bioinformatics tool was used to identify circRNAs that putatively target miR-4638-3p (Fig. 1). We retrieved 8125 circRNAs predicted to target miR-4638-3p, and filtering by cell type (BC or MCF-7), number of algorithms (two), and site type (7mer-m8 or 8mer-1A), the number of circRNAs was reduced 20. WebBase and TarBase were used to identify an unvalidated list of 10 circRNAs that putatively target miR-4638-3p (Table 1).

<italic>In-silico</italic> identification of circRNAs that putatively target miR-4638-3p.
Fig. 1  In-silico identification of circRNAs that putatively target miR-4638-3p.

CSCD, cancer-specific circRNA database; circRNA, circular RNA; mRNA, messenger RNA; miRNAs, microRNAs; MRE, miRNA response element.

TGF-β1 regulated the expression of circRNA that putatively targets miR-4638-3p in hBC cells

RT-qPCR was performed to determine the presence and expression pattern of the above-shortlisted circRNAs in hBC cells. Following TGF-β1 stimulation, several circRNAs were upregulated or downregulated in MDA-MB231 cells (Fig. 2). Of the expression profiles, circ_MCC, circ_PLEKHGH, circ_TOB1, circ_ETV6, and circ_BAGE2 were downregulated at the tested times of TGF-β1-treatment, compared with the MDA-MB231 control cells. In contrast, circ_DISP3, circ_RALGAPA2, circ_AC004922.1, circ_chr18_48962211-48965520, and circ_RAF1 were significantly upregulated at each TGF-β1 treatment time compared with their control cells (Fig. 2). Circ_DISP3 was significantly upregulated at 2 and 8 h of TGF-β1-treatment compared with their respective control (Fig. 2c).

Differential expression profiles of circRNAs in hBC cells upon TGF-β1-treatment.
Fig. 2  Differential expression profiles of circRNAs in hBC cells upon TGF-β1-treatment.

MDA-MB231 cells were either left untreated or treated with TGF-β1 (5 ng/mL) for 1, 2, 4, 8, or 24 h. Total RNA was isolated, cDNA synthesized, and subjected to qPCR analysis with primers for circRNAs and RPL13AB. Relative expression profiles of (a) circ_MCC; circ_AC004922.1; circ_chr18_48962211-48965520; circ_PLEKHGH, (b) circ_TOB1; circ_RAF1; circ_ETV6, (c) circ_DISP3; circ_RALGAPA2, and (d) circ_BAGE2. RPL13AB was used for normalization. *p < 0.05; #p < 0.05 compared with the control. cDNA, complementary DNA; circRNAs, circularRNAs; qPCR, real-time PCR; TGF-β1, transforming growth factor-beta 1.

In addition to MDA-MB231 cells, we also determined the expression of circ_DISP3 in other TNBC cell lines. Upregulation of circ_DISP3 was observed in both MDA-MB453 and MDA-MB468 cells 1, 2, 4 and 24 h) (Fig. 3a, b). The results were consistent with the expression profiles of circ_DISP3, especially at 2 h of TGF-β1-treatment in MDA-MB231 cells (Fig. 2c).

TGF-β1 regulated the expression of circ_DISP3 in MDA-MB453 and MDA-MB468 cells.
Fig. 3  TGF-β1 regulated the expression of circ_DISP3 in MDA-MB453 and MDA-MB468 cells.

MDA-MB453 and MDA-MB468 cells were treated with TGF-β1 (5 ng/mL) for 1, 2, 4, 8, or 24 h or untreated (control). Total RNA was isolated, cDNA was synthesized, and qPCR analysis was carried out. Relative expression of (a) circ_DISP3 in MDA-MB453 and (b) circ_DISP3 in MDA-MB468. RPL13AB was used as an internal control for normalization. *p < 0.05 compared with the control, #p < 0.05 compared with the control, **p < 0.01 compared with the control. cDNA, complementary DNA; circRNAs, circularRNAs; qPCR, real-time PCR; TGF-β1, transforming growth factor-beta 1; TNBC, triple-negative breast cancer.

ASO-mediated silencing of circ_DISP3 downregulated ATF3 expression in hBC cells

As TGF-β1 upregulated the expression of circ_DISP3 in hBC cells (Figs. 2 and 3), its functional role was determined. MDA-MB231 cells were transiently transfected with negative control or ASO for circ_DISP3, followed by control or TGF-β1 treatment. Whole-cell lysates were collected and assayed by western blotting the antibodies against ATF3 and alpha tubulin. TGF-β1 increased ATF3 expression in MDA-MB231 cells compared to the transfection. negative controls. The silencing of circ_DISP3 with ASO decreased the ATF3 expression seen in TGF-β1-stimulated cells, compared with their negative transfection control groups (Fig. 4). Therefore, the silencing of circ_DISP3 caused a decrease in TGF-β1-stimulated ATF3 expression in hBCs, and the effect may have been caused loss of the targeting of miR-4638-3p cells.

ASO-mediated silencing of circ_DISP3 decreased TGF-β1-stimulated ATF3 expression in hBC cells.
Fig. 4  ASO-mediated silencing of circ_DISP3 decreased TGF-β1-stimulated ATF3 expression in hBC cells.

MDA-MB231 cells were transiently transfected with negative control or ASO_circ_DISP3, followed by 2 h TGF-β1-treatment. Whole-cell lysates were collected and subjected to western blot assays using anti-ATF3 antibody. Alpha tubulin was the normalization control. ASO, antisense oligonucleotide; ATF3, activating transcription factor 3; MW, molecular weight; TGF-β1, transforming growth factor-beta 1.

circ_DISP3 directly interacted with miR-4638-3p in hBC cells

We previously reported that miR-4638-3p directly targeted ATF3.18 In this study, silencing of circ_DISP3 decreases ATF3 expression in hBC cells (Fig. 4). Hence, we hypothesized that circ_DISP3 acted as a sponge toward miR-4638-3p, resulting in increased ATF3 expression in hBC cells. We next determined whether circ_DISP3 directly interacted with miR-4638-3p using a dual-luciferase reporter assay system. Various bioinformatics tools, such as miRBase and CSCD 2.0, STarMiR, were used to identify the presence of MREs in circ_DISP3 toward miR-4638-3p. Of four predicted sites, (5–25) had excellent logit prob scores for circ_DISP3 and miR-4638-3p (Fig. 5a). To determine their direct interaction, MDA-MB-231 cells were transiently cotransfected with pCMV-MIR or pCMV-MIR4638 in the presence of pmirGLO or wild-type MRE or mutant MRE constructs of circ_DISP3 in pmirGLO. We observed a significant decrease in luciferase activity when the cells were cotransfected with wild-type circ_DISP3 constructs and pCMV-MIR4638. In contrast, there were no substantial changes in luciferase activity following cotransfection of mutant circ_DISP3 or pmirGLO constructs with pCMV-MIR or pCMV-MIR4638 (Fig. 5b). The results confirm the direct binding between miR-4638-3p and circ_DISP3 in hBC cells.

Direct targeting of miR-4638-3p with circ_DISP3 in MDA-MB231 cells.
Fig. 5  Direct targeting of miR-4638-3p with circ_DISP3 in MDA-MB231 cells.

(a) A pictorial representation of binding between miR-4638-3p seed site and MRE of circ_DISP3 (wild-type and mutant binding sites). Nucleotides in blue, green, and red indicate circ_DISP3 MRE, seed site of miR-4638-3p, and mutated circ_DISP3 MRE, respectively. (b) Cells were cotransfected with pCMV-MIR or pCMV-MIR4638 along with pmirGLO or wild-type or mutant constructs of circ_DISP3. Lysates were collected 24 h after transfection, and the relative luciferase activity was measured after normalization with Renilla luciferase activity. ##p< 0.01 compared with pmirGLO or mutant circ_DISP3 under negative control (pCMV-MIR) or pCMV-MIR4638 transfection. MRE, miRNA response element.

Discussion

Several studies have found that cytokines and growth factors such as interleukins, TNF-α, TGF-β, colony-stimulating factor 1, and VEGF have a key role in inducing BC metastasis. In the early stages of tumorigenesis, TGF-β has tumor suppression activity such as cell cycle arrest and apoptosis.32 In contrast in later stages of cancer, TGF-β increases tumor progression and metastasis by increasing cell invasion, migration, and resistance to treatment.33

Like TGF-β, ATF3 has a dichotomous role in hBC cells. In untransformed mammary epithelial cells, ATF3 expression was observed to be low, and it stimulated cell apoptosis. In. contrast ATF3 expression enhanced cell proliferation and invasion in BC cells.34,35 Our previous studies demonstrated that TGF-β1-stimulation in MDA-MB231 cells results in persistent and continuous ATF3 expression. This effect could be due to its interaction with factors like SMAD4 and NFATC2 in stabilizing ATF3 in these cells.6 ATF3 was also seen to influence the expression of its direct downstream target genes, such as cyclin A, Runx2, and MMP-13 to facilitate BC development and bone metastasis.15–17

In addition to cytokines and stress signals, ATF3 is regulated by several short ncRNAs (miRNA, siRNA, shRNA) and lncRNAs (circRNA, linear long ncRNA).19,21 Recent studies have attempted post-transcriptional regulation of ATF3 using many ncRNAs. For example, Rohini et al. reported that the downregulation of miR-590-3p was responsible for the increased expression of ATF3 and Runx2 in hBC cells, thereby inhibiting cell apoptosis and promoting cell proliferation.8 Song et al. found that miR-590-3p controlled ATF3, thus regulating carcinogenesis.36 MiR-590-3p influenced BC by targeting GOLPH3, a Golgi-related gene, in addition to ATF3, which in turn affected the ATF3/miR-590/GOLPH3 signaling cascade, and inhibited proliferation of BC cells. Akshaya et al. reported that TGF-β1 treatment substantially reduced the expression of miR-4638-3p in BC cells and that overexpression suppressed BC progression and invasion and induced apoptosis by targeting ATF3.18 This study emphasizes the role of miR-4638-3p as a therapeutic target for bone-metastatic BC.

CircRNAs have gained interest in recent years as potential new cancer diagnostic and prognostic biomarkers.37 circRNAs regulate gene transcription by acting as miRNA sponges to mediate biological functions.38 For example, Chen et al. previously reported that circ-MALAT1 increased the expression of the oncogene JAK2 by sponging miR-6887-3p to enhance self-renewal of liver cancer stem cells.39 Zheng et al. found a positive correlation of the expression levels of circSEPT9 and leukemia inhibitory factor.40 Increased circSEPT9 expression upregulated the expression levels of cancer progression genes, LIF, phosphor-STAT3, ID1, and MDM2 by sponging miR-637. Upregulation of circSEPT9 in TNBC tissue spontaneously increased lung metastasis with an increase in the number of metastatic nodules. Li et al. reported that upregulation of circMMP11 indirectly regulated the expression level of MMP11 (matrix metalloproteinase-11), a paracrine factor in invasive BC.41 The increased expression of circMMP11 was found to be associated with the proliferation, migration, and invasion of BC cells.

In this study, we identified the molecular mechanism by which these ncRNAs (miRNA and circRNAs) regulated the expression pattern of ATF3 in hBC cells. In-silico analysis using CSCD 2.0 identified circRNAs that putatively target miR-4638-3p (Fig. 1 and Table 1). Of those circRNAs, TGF-β1-stimulation increased the expression of circ_DISP3 in hBC cells (Figs. 2 and 3). Previous studies reported that upregulated circRNA acted as a sponge for miRNAs. For example, Huang et al. reported that overexpression of circRPPH1 in MDA-MB231 acted as sponges for miR-512-5p targeting STAT1 and leading to BC progression and invasion.42 More convincingly, circFBXW7 overexpression reduced tumor growth by preventing cell migration and cancer cell proliferation both in vitro and in vivo.42 CircFBXW7 inhibited the growth and metastasis of TNBC by upregulating the expression of FBXW7 and sponging miR-197-3p.43 In addition to the highly invasive cell line MDA-MB231, we have also checked the expression of circ_DISP3 in other TNBC cells, MDA-MB453, and MDA-MB468.44–46 The circ_DISP3 expression pattern was consistent in all three hBC cell lines. There is evidence of the difference in the expression pattern of genes in different cell lines, but that was not the case for the circRNA in our study.47

As TGF-β1 upregulated the expression of circ_DISP3, its functional role was determined by ASO-mediated silencing of circ_DISP3. Our results suggest that the silencing of circ_DISP3 by ASO transfection downregulated TGF-β1-stimulated ATF3 expression in MDA-MB231 cells (Fig. 4). This might be attributed to the increase of miR-4638-3p expression level due to the lack of miRNA targeting by the circRNA. Løvendorf et al. reported that the knockdown of circRNA using ASO led to the functional loss of circRNA in vitro and in vivo.48 Xu et al. reported that targeting circIKBKB via ASO delayed the incidence of bone metastasis in BC cells.49 Similarly, in female BALB/C nude mice, ASO-mediated silencing of circRNA progesterone receptor was observed to suppress estrogen receptor-positive BC cell growth by sponging miR-301a-5p.50

A luciferase assay was performed to further understand the mechanism of miR-4638-3p and circ_DISP3 binding. The results revealed the direct interaction of miR-4638-3p with the MRE of circ_DISP3 (Fig. 5). The direct interaction of circRNAs with miRNAs has previously been identified by luciferase reporter assays.51,52 CircRNAs serve as miRNA sponges to inhibit miRNA activity and regulate the expression of their target genes. For example, circ_CUX1 regulates p300-mediated Runx2 acetylation in rat osteoblastic cells by acting as a sponge for miR-130b-5p. The knockdown of circ_CUX1 led to the upregulation of miR-130b-5p, thereby reducing the expression level of p300.53

Conclusion

Overall, our results show that TGF-β1 stimulated the expression of ATF3 via the stimulation and sponging activity of circ_DISP3 toward miR-4638-3p in hBC cells. The knockdown of circ_DISP3 reversed the effect of TGF-β1, i.e., ATF3 expression decreased via lack of targeting of miR-4638-3p in those cells. TGF-β1-regulation of circ_DISP3/miR-4638-3p/ATF3 axis thus had a pivotal role in BC progression and bone metastasis (Fig. 6). Further, in vitro and in vivo studies need to be carried out to validate and support these findings for clinical application.

Schematic representation of TGF-β1-mediated ATF3 expression in hBC cells.
Fig. 6  Schematic representation of TGF-β1-mediated ATF3 expression in hBC cells.

TGF-β1 increased the expression level of circ_DISP3, causing the sponging activity toward miR-4638-3p and increasing ATF3 expression in hBC cells. Whereas the ASO-mediated silencing of circ_DISP3 facilitated the nontargeting of miR-4638-3p, decreasing ATF3 expression in these cells. ASO, antisense oligonucleotides; ATF3, activating transcription factor 3; BC, breast cancer; TGF-β1, transforming growth factor-beta 1.

Abbreviations

ASO: 

antisense oligonucleotides

ATF3: 

activating transcription factor 3

BC: 

breast cancer

cDNA: 

complementary DNA

ceRNA: 

competing endogenous RNA

circRNA: 

circular RNA

CSCD: 

cancer-specific CircRNA database

lncRNA: 

long noncoding RNAs

miRNA: 

microRNA

MRE: 

miRNA response element

MMP13: 

matrix metalloproteinase 13

MW: 

molecular weight

ncRNA: 

noncoding RNA

PCR: 

polymerase chain reaction

qPCR: 

real-time PCR

SDS-PAGE: 

sodium dodecyl-sulfate polyacrylamide gel electrophoresis

S. no: 

serial number

TGF-β: 

transforming growth factor-beta

TNBC: 

triple-negative breast cancer

Declarations

Acknowledgement

There is nothing to declare.

Data availability

The corresponding author will provide the results produced during the current investigation upon reasonable request.

Funding

The Indian Council of Medical Research (2020-0282/SCR/ADHOC-BMS to NS) and the Department of Science and Technology (DST/INSPIRE Fellowships: 2021/IF210073 to I. S.) provided funding for this research.

Conflict of interest

There are no known conflicting financial or personal interests that could have affected the research described in the study.

Authors’ contributions

Study concept and design (NS, IS), in-silico analysis (SM, ASMR), performing the experiments (IS, RLA, SM, IM, RK), technical assistance (SG, SK), manuscript preparation (SM, ASMR, RK, IM, KS, IS), and study supervision, content assessment and funding (NS). All authors made a significant contribution to this study and approved the final manuscript.

References

  1. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin 2021;71(3):209–249 View Article PubMed/NCBI
  2. Scott LC, Mobley LR, Kuo TM, Il’yasova D. Update on triple-negative breast cancer disparities for the United States: A population-based study from the United States Cancer Statistics database, 2010 through 2014. Cancer 2019;125(19):3412–3417 View Article PubMed/NCBI
  3. Deepak KGK, Vempati R, Nagaraju GP, Dasari VR, S N, Rao DN, et al. Tumor microenvironment: Challenges and opportunities in targeting metastasis of triple negative breast cancer. Pharmacol Res 2020;153:104683 View Article PubMed/NCBI
  4. Lu X, Kang Y. Organotropism of breast cancer metastasis. J Mammary Gland Biol Neoplasia 2007;12(2-3):153–162 View Article PubMed/NCBI
  5. Feser R, Opperman RM, Nault B, Maiti S, Chen VC, Majumder M. Breast cancer cell secretome analysis to decipher miRNA regulating the tumor microenvironment and discover potential biomarkers. Heliyon 2023;9(4):e15421 View Article PubMed/NCBI
  6. Rohini M, Vairamani M, Selvamurugan N. TGF-β1-stimulation of NFATC2 and ATF3 proteins and their interaction for matrix metalloproteinase 13 expression in human breast cancer cells. Int J Biol Macromol 2021;192:1325–1330 View Article PubMed/NCBI
  7. Yan L, Gaddis S, Coletta LD, Repass J, Powell KL, Simper MS, et al. ATF3-Induced Mammary Tumors Exhibit Molecular Features of Human Basal-Like Breast Cancer. Int J Mol Sci 2021;22(5):2353 View Article PubMed/NCBI
  8. Rohini M, Gokulnath M, Miranda PJ, Selvamurugan N. miR-590-3p inhibits proliferation and promotes apoptosis by targeting activating transcription factor 3 in human breast cancer cells. Biochimie 2018;154:10–18 View Article PubMed/NCBI
  9. Wei S, Wang H, Lu C, Malmut S, Zhang J, Ren S, et al. The activating transcription factor 3 protein suppresses the oncogenic function of mutant p53 proteins. J Biol Chem 2014;289(13):8947–8959 View Article PubMed/NCBI
  10. Chang YS, Jalgaonkar SP, Middleton JD, Hai T. Stress-inducible gene Atf3 in the noncancer host cells contributes to chemotherapy-exacerbated breast cancer metastasis. Proc Natl Acad Sci U S A 2017;114(34):E7159–E7168 View Article PubMed/NCBI
  11. Shukla N, Naik A, Moryani K, Soni M, Shah J, Dave H. TGF-β at the crossroads of multiple prognosis in breast cancer, and beyond. Life Sci 2022;310:121011 View Article PubMed/NCBI
  12. Verras GI, Tchabashvili L, Mulita F, Grypari IM, Sourouni S, Panagodimou E, et al. Micropapillary Breast Carcinoma: From Molecular Pathogenesis to Prognosis. Breast Cancer (Dove Med Press) 2022;14:41–61 View Article PubMed/NCBI
  13. Wang J, Xiang H, Lu Y, Wu T. Role and clinical significance of TGF-β1 and TGF-βR1 in malignant tumors (Review). Int J Mol Med 2021;47(4):55 View Article PubMed/NCBI
  14. Wakefield LM, Letterio JJ, Chen T, Danielpour D, Allison R, Pai LH, et al. Transforming growth factor-beta1 circulates in normal human plasma and is unchanged in advanced metastatic breast cancer. Clin Cancer Res1 1995;1(1):129–136 View Article PubMed/NCBI
  15. Kwok S, Rittling SR, Partridge NC, Benson CS, Thiyagaraj M, Srinivasan N, et al. Transforming growth factor-beta1 regulation of ATF-3 and identification of ATF-3 target genes in breast cancer cells. J Cell Biochem 2009;108(2):408–414 View Article PubMed/NCBI
  16. Gokulnath M, Swetha R, Thejaswini G, Shilpa P, Selvamurugan N. Transforming growth factor-β1 regulation of ATF-3, c-Jun and JunB proteins for activation of matrix metalloproteinase-13 gene in human breast cancer cells. Int J Biol Macromol 2017;94(Pt A):370–377 View Article PubMed/NCBI
  17. Rohini M, Arumugam B, Vairamani M, Selvamurugan N. Stimulation of ATF3 interaction with Smad4 via TGF-β1 for matrix metalloproteinase 13 gene activation in human breast cancer cells. Int J Biol Macromol 2019;134:954–961 View Article PubMed/NCBI
  18. Akshaya RL, Rohini M, He Z, Partridge NC, Selvamurugan N. MiR-4638-3p regulates transforming growth factor-β1-induced activating transcription factor-3 and cell proliferation, invasion, and apoptosis in human breast cancer cells. Int J Biol Macromol 2022;222(Pt B):1974–1982 View Article PubMed/NCBI
  19. Sobhani N, Chahwan R, Roudi R, Morris R, Volinia S, Chai D, et al. Predictive and Prognostic Value of Non-Coding RNA in Breast Cancer. Cancers (Basel) 2022;14(12):2952 View Article PubMed/NCBI
  20. Yang S, Wang X, Zhou X, Hou L, Wu J, Zhang W, et al. ncRNA-mediated ceRNA regulatory network: Transcriptomic insights into breast cancer progression and treatment strategies. Biomed Pharmacother 2023;162:114698 View Article PubMed/NCBI
  21. Luo Y, Tang W, Xiang S, Feng J, Zu X. Non-coding RNAs in breast cancer: Implications for programmed cell death. Cancer Lett 2022;550:215929 View Article PubMed/NCBI
  22. Malla RR, Kumari S, Gavara MM, Badana AK, Gugalavath S, Kumar DKG, et al. A perspective on the diagnostics, prognostics, and therapeutics of microRNAs of triple-negative breast cancer. Biophys Rev 2019;11(2):227–234 View Article PubMed/NCBI
  23. Wang H, Tan Z, Hu H, Liu H, Wu T, Zheng C, et al. microRNA-21 promotes breast cancer proliferation and metastasis by targeting LZTFL1. BMC Cancer 2019;19(1):738 View Article PubMed/NCBI
  24. Hunter S, Nault B, Ugwuagbo KC, Maiti S, Majumder M. Mir526b and Mir655 Promote Tumour Associated Angiogenesis and Lymphangiogenesis in Breast Cancer. Cancers (Basel) 2019;11(7):938 View Article PubMed/NCBI
  25. Tian T, Zhao Y, Zheng J, Jin S, Liu Z, Wang T. Circular RNA: A potential diagnostic, prognostic, and therapeutic biomarker for human triple-negative breast cancer. Mol Ther Nucleic Acids 2021;26:63–80 View Article PubMed/NCBI
  26. Liu J, Qiu G, Wang H, Li N, Liao X. CircRNA-ABCB10 promotes gastric cancer progression by sponging miR-1915-3p to upregulate RaC1. Dig Liver Dis 2022;54(7):896–904 View Article PubMed/NCBI
  27. Song B, Xu C, Zhang Y, Shan Y. Circ_ATAD3B inhibits cell proliferation of breast cancer via mediating the miR-570-3p/MX2 axis. Prev Med 2023;173:107568 View Article PubMed/NCBI
  28. Sun J, Li L, Chen X, Yang C, Wang L. The circRNA-0001361/miR-491/FGFR4 axis is associated with axillary response evaluated by ultrasound following NAC in subjects with breast cancer. Biochem Biophys Rep 2023;34:101481 View Article PubMed/NCBI
  29. Akshaya N, Srinaath N, Rohini M, Ilangovan R, Selvamurugan N. Parathyroid Hormone-regulation of Runx2 by MiR-290 for Matrix Metalloproteinase-13 Expression in Rat Osteoblastic Cells. Curr Mol Med 2022;22(6):549–561 View Article PubMed/NCBI
  30. Saiganesh S, Saathvika R, Arumugam B, Vishal M, Udhaya V, Ilangovan R, et al. TGF-β1-stimulation of matrix metalloproteinase-13 expression by down-regulation of miR-203a-5p in rat osteoblasts. Int J Biol Macromol 2019;132:541–549 View Article PubMed/NCBI
  31. Malavika D, Shreya S, Raj Priya V, Rohini M, He Z, Partridge NC, et al. miR-873-3p targets HDAC4 to stimulate matrix metalloproteinase-13 expression upon parathyroid hormone exposure in rat osteoblasts. J Cell Physiol 2020;235(11):7996–8009 View Article PubMed/NCBI
  32. Méndez-García LA, Nava-Castro KE, Ochoa-Mercado TL, Palacios-Arreola MI, Ruiz-Manzano RA, Segovia-Mendoza M, et al. Breast Cancer Metastasis: Are Cytokines Important Players During Its Development and Progression? J Interferon Cytokine Res 2019;39(1):39–55 View Article PubMed/NCBI
  33. Gu S, Feng XH. TGF-β signaling in cancer. Acta Biochim Biophys Sin (Shanghai) 2018;50(10):941–949 View Article PubMed/NCBI
  34. Thompson MR, Xu D, Williams BR. ATF3 transcription factor and its emerging roles in immunity and cancer. J Mol Med (Berl) 2009;87(11):1053–1060 View Article PubMed/NCBI
  35. Ku HC, Cheng CF. Master Regulator Activating Transcription Factor 3 (ATF3) in Metabolic Homeostasis and Cancer. Front Endocrinol (Lausanne) 2020;11:556 View Article PubMed/NCBI
  36. Song Q, Chen Q, Wang Q, Yang L, Lv D, Jin G, et al. ATF-3/miR-590/GOLPH3 signaling pathway regulates proliferation of breast cancer. BMC Cancer 2018;18(1):255 View Article PubMed/NCBI
  37. Zhou Q, Ju LL, Ji X, Cao YL, Shao JG, Chen L. Plasma circRNAs as Biomarkers in Cancer. Cancer Manag Res 2021;13:7325–7337 View Article PubMed/NCBI
  38. Gu A, Jaijyan DK, Yang S, Zeng M, Pei S, Zhu H. Functions of Circular RNA in Human Diseases and Illnesses. Noncoding RNA 2023;9(4):38 View Article PubMed/NCBI
  39. Chen L, Kong R, Wu C, Wang S, Liu Z, Liu S, et al. Circ-MALAT1 Functions as Both an mRNA Translation Brake and a microRNA Sponge to Promote Self-Renewal of Hepatocellular Cancer Stem Cells. Adv Sci (Weinh) 2020;7(4):1900949 View Article PubMed/NCBI
  40. Zheng X, Huang M, Xing L, Yang R, Wang X, Jiang R, et al. The circRNA circSEPT9 mediated by E2F1 and EIF4A3 facilitates the carcinogenesis and development of triple-negative breast cancer. Mol Cancer 2020;19(1):73 View Article PubMed/NCBI
  41. Li Z, Chen Z, Feng Y, Hu G, Jiang Y. CircMMP11 acts as a ce-circRNA in breast cancer progression by regulating miR-1204. Am J Transl Res 2020;12(6):2585–2599 View Article PubMed/NCBI
  42. Huang Y, Zheng W, Ji C, Wang X, Yu Y, Deng X, et al. Circular RNA circRPPH1 promotes breast cancer progression via circRPPH1-miR-512-5p-STAT1 axis. Cell Death Discov 2021;7(1):376 View Article PubMed/NCBI
  43. Ye F, Gao G, Zou Y, Zheng S, Zhang L, Ou X, et al. circFBXW7 Inhibits Malignant Progression by Sponging miR-197-3p and Encoding a 185-aa Protein in Triple-Negative Breast Cancer. Mol Ther Nucleic Acids 2019;18:88–98 View Article PubMed/NCBI
  44. Mohammed F, Rashid-Doubell F, Taha S, Cassidy S, Fredericks S. Effects of curcumin complexes on MDA-MB-231 breast cancer cell proliferation. Int J Oncol 2020;57(2):445–455 View Article PubMed/NCBI
  45. Ai H, Zhou W, Wang Z, Qiong G, Chen Z, Deng S. microRNAs-107 inhibited autophagy, proliferation, and migration of breast cancer cells by targeting HMGB1. J Cell Biochem 2019;120(5):8696–8705 View Article PubMed/NCBI
  46. Wojtowicz W, Wróbel A, Pyziak K, Tarkowski R, Balcerzak A, Bębenek M, et al. Evaluation of MDA-MB-468 Cell Culture Media Analysis in Predicting Triple-Negative Breast Cancer Patient Sera Metabolic Profiles. Metabolites 2020;10(5):173 View Article PubMed/NCBI
  47. Agrawal P, Gopalan V, Hannenhalli S. Predicting gene expression changes upon epigenomic drug treatment. bioRxiv 2023 View Article PubMed/NCBI
  48. Løvendorf MB, Holm A, Petri A, Thrue CA, Uchida S, Venø MT, et al. Knockdown of Circular RNAs Using LNA-Modified Antisense Oligonucleotides. Nucleic Acid Ther 2023;33(1):45–57 View Article PubMed/NCBI
  49. Xu Y, Zhang S, Liao X, Li M, Chen S, Li X, et al. Circular RNA circIKBKB promotes breast cancer bone metastasis through sustaining NF-κB/bone remodeling factors signaling. Mol Cancer 2021;20(1):98 View Article PubMed/NCBI
  50. Wang L, Yi J, Lu LY, Zhang YY, Wang L, Hu GS, et al. Estrogen-induced circRNA, circPGR, functions as a ceRNA to promote estrogen receptor-positive breast cancer cell growth by regulating cell cycle-related genes. Theranostics 2021;11(4):1732–1752 View Article PubMed/NCBI
  51. Zhang X, Wang S, Wang H, Cao J, Huang X, Chen Z, et al. Circular RNA circNRIP1 acts as a microRNA-149-5p sponge to promote gastric cancer progression via the AKT1/mTOR pathway. Mol Cancer 2019;18(1):20 View Article PubMed/NCBI
  52. Chen J, Chen T, Zhu Y, Li Y, Zhang Y, Wang Y, et al. circPTN sponges miR-145-5p/miR-330-5p to promote proliferation and stemness in glioma. J Exp Clin Cancer Res 2019;38(1):398 View Article PubMed/NCBI
  53. Krishnan RH, Sadu L, Akshaya RL, Gomathi K, Saranya I, Das UR, et al. Circ_CUX1/miR-130b-5p/p300 axis for parathyroid hormone-stimulation of Runx2 activity in rat osteoblasts: A combined bioinformatic and experimental approach. Int J Biol Macromol 2023;225:1152–1163 View Article PubMed/NCBI

About this Article

Cite this article
Mohan S, Bharathy A, Induja M, Kolipaka R, Karthik S, Ganesamoorthi S, et al. Transforming Growth Factor-β1-mediated Regulation of circ_DISP3 and ATF3 in Human Triple-negative Breast Cancer Cells. Gene Expr. 2023;22(4):297-305. doi: 10.14218/GE.2023.00101.
Copy Export to RIS Export to EndNote
Article History
Received Revised Accepted Published
August 22, 2023 September 6, 2023 September 20, 2023 October 26, 2023
DOI http://dx.doi.org/10.14218/GE.2023.00101