Home
JournalsCollections
For Authors For Reviewers For Editorial Board Members
Article Processing Charges Open Access
Ethics Advertising Policy
Editorial Policy Resource Center
Company Information Contact Us Membership Collaborators Partners
Publications > Journals > Gene Expression> Article Full Text
OPEN ACCESS

Association between 15 Insertion/Deletion Polymorphisms and the Risk of Type 1 Bipolar Disorder

  • Fatemeh Zebarjad and
  • Mostafa Saadat* 
Gene Expression   2025;24(2):95-101

doi: 10.14218/GE.2023.00159

Received:

Revised:

Accepted:

Published online:

 Author information

Citation: Zebarjad F, Saadat M. Association between 15 Insertion/Deletion Polymorphisms and the Risk of Type 1 Bipolar Disorder. Gene Expr. 2025;24(2):95-101. doi: 10.14218/GE.2023.00159.

Abstract

Background and objectives

Type 1 bipolar disorder (BP) is a mental illness characterized by extreme shifts in mood, oscillating between manic and depressive episodes. It ranks as the sixth most prevalent psychiatric disorder globally, often emerging in the teenage years. This study aimed to identify associations between BP and 15 insertion/deletion (Indel) polymorphisms in the human genome, examining genes including TPA, UCP2, HLA-G, FADS2, ADRA2B, VEGF, PDCD6IP, SLC6A4, TLR2, APOB, TP53, LRPAP1, DHFR, MDM2, and DBH.

Methods

This case-control study involved 226 patients with BP and 235 healthy controls. Allele frequencies for each polymorphism in cases and controls were estimated using pooled samples. Polymerase chain reaction was performed for each Indel polymorphism using pooled samples as templates to estimate allele frequencies.

Results

The data presented herein demonstrate a significant association between a 14bp Ins/Del polymorphism in the HLA-G gene and the risk of BP. The deletion allele of this polymorphism increased the risk of BP (odds ratio = 1.434, 95% confidence interval = 1.106–1.859, p = 0.007). Other 14 Indel polymorphisms were not associated with the risk of BP.

Conclusions

The HLA-G 14bp Indel polymorphism exhibits a significant correlation with the risk of BP in this study. This finding contributes to understanding the etiology of BP.

Keywords

Bipolar disorder, Case-control, Indel, Polymorphisms, Pooled samples, Susceptibility

Introduction

Bipolar disorder (BP) is a complex mental illness that involves rapid mood swings between manic and depressive states, often interspersed with periods of normalcy. Within the bipolar spectrum of mental disorders, bipolar type 1 and type 2 are commonly diagnosed subtypes. Affecting more than 1% of the global population, BP remains a significant mental health problem.1 The exact etiology of BP remains unclear. However, research has shown that the disorder is complex and multifactorial, with multiple genetic elements. According to family, twin, and adoptee studies, the heritability of the disorder is in the range of 70–90%, indicating a significant hereditary role in its pathogenesis.2,3

Genetic polymorphisms can be categorized into several classes, including insertion/deletion (Indel). Indels are defined as short insertions and deletions (ranging from one to 10,000 bp) in the genome.4,5 In the human genome, Indels are the second most common group of genetic variation after single nucleotide polymorphisms. The 1000 Genomes Project results reveal the identification of over 3.4 million Indels in the human genome.6 Due to the identification of Indels in exons and promoters of known genes, where gene function is expected to be affected,6 these have become important sources for genetic association studies. The association between Indel genetic variations and the risk of various diseases has been extensively studied, leading to a wealth of available meta-analyses.7–10 However, only a limited number of published articles have explored the relationship between Indel polymorphisms and the risk of bipolar disorder.11–16

Several genetic polymorphisms in genes such as APOB,17,18FADS2,19,20LRPAP1,21VEGF,22DBH,23SLC6A4,24–26HLA-G,15,16 and TLR2 have been associated with increased risks of BP in genome-wide scans or case-control studies.27 Literature has demonstrated that the expression of UCP2 and TPA genes is decreased in BP patients.28,29 While TP53 gene expression is increased. In addition, proteomic analysis has indicated differences in PDCD6IP levels between BP patients and controls.30,31 The serum level of vascular endothelial growth factor (VEGF) was found to be heightened in individuals with BP.32 Multiple sources indicate that although both BP and schizophrenia share common signs and symptoms, they also share certain genetic and non-genetic risk factors.33,34 However, it is worth noting that the polymorphic loci associated with the risk of these two disorders are not entirely identical.35 Of course, not all polymorphic loci are the same; several studies demonstrate the relationship between the same polymorphic variant and the risk of developing both BP and schizophrenia, such as the rs2228145 polymorphism in IL6R and the rs1801133 in MTHFR.36,37 Polymorphisms in the MDM2,38MTHFR,37 and ADRA2B genes have also been associated with an increased risk of schizophrenia.39 Taken together, it is reasonable to suggest that the Indel polymorphisms identified in the aforementioned genes may be associated with an increased risk of developing BP.

Recently, we investigated the association between 15 common Indel polymorphisms and the risk of schizophrenia.17 However, there has been no similar study on BP. To further elucidate the genetic basis of BP and to identify new candidate risk factors among common genetic polymorphisms, we investigated the association of these 15 different Indel polymorphisms in the genes mentioned in the previous paragraph with the risk of BP. Utilizing pooled samples to estimate allele frequency is a straightforward, economical, and quick approach. This study analyzed the allele frequencies of these 15 Indel polymorphisms among BP patients and control subjects employing this technique.

Materials and methods

Participants

The current research study is a case-control study conducted in Shiraz, Southern Iran. A comprehensive overview of the study participants is available in earlier publications.11,22 BP type 1 diagnoses were established by a psychiatrist according to the Diagnostic and Statistical Manual of Mental Disorders, 4th edition (DSM-IV) criteria. The patients’ status was confirmed as symptomatic cases. Patients belonging to ethnicities other than Persian, such as Arabs, Afghans, Azaris, and Turkmen, were excluded from the study.

Two hundred and twenty-six participants diagnosed with type 1 BP (167 males, 59 females; mean age ± SD = 29.0 ± 10.6 years) and 235 healthy individuals (179 males, 56 females; mean age ± SD = 29.2 ± 10.3 years) were previously reported to be considered in the study.11,40 No significant difference in gender (χ2 = 0.31, df = 1, p = 0.572) and age distribution (t = 0.21, df = 459, p = 0.837) was apparent between cases and controls, signifying appropriate group matching.

The sample size was determined using Epi Info software (version 7.2.2.6). To establish a significant difference in the allelic frequency of Indel polymorphisms between patients and controls, a minimum sample size of 201 patients was required. This calculation was based on an assumed frequency of 35% for Del alleles, equal numbers of cases and controls, an expected strength of association of 1.50, a statistical power of 0.80, and a significance level of α = 0.05. The study ultimately included 226 patients and 235 controls.

Considering that the gene pool of the Iranian population is highly heterogeneous,41,42 in order to rule out this point in our study findings, we selected both BP patients and control subjects from a single gene pool. All study participants were Caucasian/Muslim residents of Shiraz (Fars province of Iran). The Shiraz University Ethics Committee approved the study, and informed consent was obtained from each participant.

Genes studied

The frequencies of Ins and Del alleles of the following genes were compared between BP cases and controls: DBH 19bp, TPA 311bp, HLA-G 14bp, UCP2 45bp, MDM2 40bp, DHFR 19bp, LRPAP1 37bp, TP53 16bp, APOB 9bp, TLR2 22bp, SLC6A4 (5-HTT) 44bp, PDCD6IP 15bp, VEGF 18bp, ADRA2B 9bp, and FADS2 22bp.

Estimation of allelic frequencies

Genomic DNA was extracted from blood samples using the boiling method.43 Here we employed a pooled method for estimating allelic frequency. This method relies on a strong relationship between the intensity of the insertion/deletion allele bands on gel electrophoresis and the relative amount of genomic DNA. Therefore, the accuracy of the correlation between DNA amount and band intensity was investigated using serial dilutions of DNA samples. The linear regression slope was calculated using a no-intercept model and was determined to be 0.998, demonstrating the high efficacy of the method in estimating the relative amount of DNA by analyzing band intensity. Band intensity was measured using ImageJ software version 1.53e. To estimate allelic frequencies, the intensity of Ins and Del bands was analyzed as described previously.44

Two sets of pooled genomic DNA samples were prepared by combining equal amounts of extracted DNA: one from the control group and the other from the patient group. For estimating allelic frequencies, pooled DNA samples were used for polymerase chain reaction (PCR) from BP patients and controls along with DNA from a heterozygous individual. The heterozygous genotype for each Indel polymorphism served as a calibration sample.44

The PCR-specific forward and reverse primers are available in Table 1. After PCR, two insertion and deletion (Ins and Del) allele bands were observed on gel electrophoresis. The intensities of the bands were measured in both pooled patient and control samples, as well as a heterozygote sample. The allele frequencies in the pooled samples were estimated utilizing the previously described formula.44 Three replicates of PCR, gel electrophoresis, and band intensity measurements were performed.

Table 1

The specific forward and reverse primers and PCR product

PCR product length (bp)Primer sequencesOMIMLoci
93/84F: 5′ ACCGGCCCTGGCGCCCGCCAGCA 3′
R: 5′ CAGCTGGCGATGGACCCGCCGA 3′
107730APOB
112/103F: 5′ CAAGCTGAGGCCGGAGACACT 3′
R: 5′ AGGGTGTTTGTGGGGCATCT 3′
104260ADRA2B
227/212F: 5′ CCTTAAGGTCTGTGTCAACC 3′
R: 5′ TATTCCTCCACTCGAACAAC 3′
308074PDCD6IP
222/185F: 5′ AGTGTGCGTGGAGCCTATG 3′
R: 5′ GGTGTTTCTGGACACAAAGGA 3′
104225LRPAP1
286/264F: 5′ CACGGAGGCAGCGAGAAA 3′
R: 5′ CTGGGCCGTGCAAAGAAG 3′
603028TLR2
119/100F: 5′ CGCAAGTCTGGCCCCATC 3′
R: 5′ TCAGGTATCTGCCGGGCC 3′
126060DHFR
230/212F: 5′ GCTGAGGATGGGGCTGACTAGGTA 3′
R: 5′ GTTTCTGACCTGGCTATTTCCAGG 3′
199240VEGF
224/210F: 5′ GTGATGGGCTGTTTAAAGTGTCACC 3′
R: 5′ GGAAGGAATGCAGTTCAGCATGA 3′
142871HLA-G
424/113F: 5′ GTAAGAGTTCCGTAACAGGACAGCT 3′
R: 5′ CCCCACCCTAGGAGAACTTCTCTTT 3′
173370TPA
166/147F: 5′ TGCAAAAATCAGGCACATGC 3′
R: 5′ TCCAATAATTTGGCCTCAATC 3′
609312DBH
502/457F: 5′ CAGTGAGGGAAGTGGGAGG 3′
R: 5′ GGGGCAGGACGAAGATTC 3′
601693UCP2
629/607F: 5′ TTTCTCAAAGGCCGTGGTGT 3′
R: 5′ AGTGCTAACCACTCCTGGAA 3′
606149FADS2
262/222F: 5′ TTTCCTTTCTGGTAGGCTGG 3′
R: 5′ CACCTACTTTCCCACAGAGA 3′
164785MDM2
195/179F: 5′ TCAAATCATCCATTGCTTGG 3′
R: 5′ TGGGACTGACTTTCTGCTCTT 3′
191170TP53
310/266F: 5′ GACATAATCTGTCTTCTGGCCTCTCAAG 3′
R: 5′ CAATGTCTGGCGCTTCCCCTACATAT 3′
182138SLC6A4

Data pooling

Eligible publications were identified by searching PubMed, Scopus, and DOAJ databases using the following keywords: “HLA-G 14 bp Indel” and “bipolar disorder”. The last search was updated on July 15, 2023. The search was not limited by language. For each study, the following information was extracted: author’s surname, year of publication, country in which the study was conducted, number of cases and controls, and number of cases and controls with respect to the genotypes of the HLA-G 14 bp Indel polymorphism. The data were extracted by the investigators, and there was no discrepancy between the two extractions. Heterogeneity among studies was measured by Cochran’s Q and I2 statistics. The random-effects model was used when heterogeneity between studies was present, and the fixed-effects model was used when heterogeneity was not present.

Statistical analysis

For each polymorphic site, we calculated the number of Ins and Del alleles by multiplying the relative frequency of each allele by twice the number of participants. We used the odds ratio (OR) and its corresponding 95% confidence interval (CI) to estimate the strength of the association between each polymorphic site and the risk of bipolar disorder type 1. It is important to note that for all comparisons, the insertion (Ins) allele was used as the reference allele (OR = 1). Data analysis was conducted utilizing SPSS software version 19, with a significance level set at a p-value below 0.05.

Ethical statement

The procedures followed in this case-control study were approved by the Ethics Committee of Shiraz University in correspondence with the ethical guidelines of the Declaration of Helsinki (as revised in 2013). Informed consent was obtained from all participants before enrolled in this study.

Results

Table 2 summarizes the results of the study, demonstrating a significant association between BP and the HLA-G polymorphism. Specifically, the deletion allele is associated with an increased risk of BP (OR = 1.43, 95% CI = 1.10–1.85, p = 0.007). The remaining 14 Indel polymorphisms show no significant association with BP risk.

Table 2

Association between 15 Indel polymorphisms and the risk of bipolar disorder

PolymorphismsAllelesCasesControlsOR95% CIp-value
MDM2
Indel 40bp
Ins(75.56) 342(72.70) 3421.0
Del(24.43) 110(27.30) 1280.8590.639–1.1550.315
VEGF
Indel 18bp
Ins(40.37) 182(42.00) 1971.0
Del(59.62) 270(58.00) 2731.0710.823–1.3920.611
TP53
Indel 16bp
Ins(30.94) 140(34.42) 1621.0
Del(69.05) 312(65.57) 3081.1720.890–1.5440.259
PDCD6IP
Indel 15bp
Ins(26.40) 119(29.23) 1371.0
Del(73.59) 333(70.76) 3331.1510.862–1.5370.339
HLA-G
Indel 14bp
Ins(46.15) 209(55.15) 2591.0
Del(53.84) 243(44.87) 2111.4271.101–1.8500.007
TLR2
Indel 22bp
Ins(77.16) 349(74.17) 3491.0
Del(22.83) 103(25.82) 1210.8510.630–1.1510.296
UCP2
Indel 45bp
Ins(25.50) 115(25.83) 1211.0
Del(74.51) 337(74.16) 3491.0160.756–1.3660.916
DHFR
Indel 19bp
Ins(60.00) 271(61.02) 2871.0
Del(40.00) 181(39.07) 1831.0470.804–1.3640.731
FADS2
Indel 22bp
Ins(53.90) 244(54.03) 2541.0
Del(46.10) 208(45.96) 2161.0020.774–1.2990.985
DBH
Indel 19bp
Ins(52.27) 236(51.70) 2431.0
Del(47.72) 216(48.30) 2270.9800.757–1.2960.877
ADRA2B
Indel 9bp
Ins(56.07) 253(51.26) 2411.0
Del(43.93) 199(48.73) 2290.8280.639–1.0730.153
TPA
Indel 311bp
Ins(52.20) 236(46.32) 2181.0
Del(47.80) 216(53.67) 2520.7920.611–1.0260.077
SLC6A4
Indel 44bp
Ins(61.34) 277(61.82) 2911.0
Del(38.65) 175(38.17) 1791.0270.788–1.3390.844
LRPAP1
Indel 37bp
Ins(14.67) 66(14.55) 681.0
Del(85.32) 386(85.44) 4020.9890.686–1.4270.954
APOB
Indel 9bp
Ins(71.35) 323(73.40) 3451.0
Del(28.64) 129(26.59) 1251.1020.826–1.4720.509

A search of PubMed, Scopus, and DOAJ databases revealed two studies investigating the association between the HLA-G 14 bp Indel and BP risk, conducted in France and India.15,16 Although the researchers reported that they observed a significant difference in genotype prevalence between BP patients and controls, they failed to find a significant difference in allelic frequencies. We extracted the raw data of allelic frequencies from these reports and performed a small meta-analysis. Our analysis showed that there was no significant heterogeneity among these three studies (Q statistic = 0.53, df = 2, p = 0.838, I2 = 0.00). The fixed-effect model was used to estimate the pooled OR and its 95% CI, which showed a strong association between the Del allele and BP risk (OR = 1.34, 95% CI: 1.15–1.57, p < 0.001; Fig. 1). A sensitivity test was performed by removing each study from the analysis, and the pooled ORs remained unchanged.

Forest plot of case-control studies used for meta-analysis to examine the association between the Del versus Ins allele of the 14 bp Indel in the <italic>HLA-G</italic> gene and the risk of bipolar disorder.
Fig. 1  Forest plot of case-control studies used for meta-analysis to examine the association between the Del versus Ins allele of the 14 bp Indel in the HLA-G gene and the risk of bipolar disorder.

Discussion

Our findings indicate a significant association between the 14bp HLA-G polymorphism and BP risk. BP is a multifactorial disorder arising from a combination of genetic and environmental factors.2,3 A non-classical HLA class I molecule critical to the immune system is encoded by the HLA-G gene, playing an important role in viral infections.45 Furthermore, evidence suggests that infectious diseases and impaired immune regulation could be implicated in BD pathogenesis.46–50 Therefore, it is reasonable to suggest that modifications in gene function may heighten BP risk. Studies indicate that this genetic polymorphism impacts the stability of HLA-G mRNA species and consequently the level of circulating sHLA-G. The Del allele is linked to lower levels of both HLA-G mRNA and circulating sHLA-G isoforms, as suggested by researchers.51–53 Moreover, some studies have suggested that reduced HLA-G expression may impair the effectiveness of immune tolerance mechanisms.

Recently, we found a positive association between the Del allele of the HLA-G 14bp Indel and schizophrenia risk.17 Our current research provides further evidence suggesting HLA-G as a common polymorphic locus for both BP and schizophrenia, alongside previously identified loci.33,34

The SLC6A4 polymorphism, previously referred to as the 44-bp insertion/deletion 5-HTTLPR, has been extensively studied in multifactorial traits, including BP.24–26 Consistent with our current finding, a number of studies have failed to find a significant association between this polymorphism and BP risk.24–26 The other Indel polymorphic loci examined in the current study, not significantly associated with BP risk, have not been previously studied.

Finally, it should be noted that this study has an important limitation that needs to be addressed. As described in the Methods section, pooled samples were used to estimate allele frequencies in both cases and controls. Although the use of this pooled sample method is associated with cost and time savings, researchers can easily study a larger number of genetic polymorphisms. In this study, we investigate the association between a substantial number of indel polymorphisms and the risk of BP. However, without information on the genotypes and risk factors of the subjects, it is impossible to study potential interactive effects between associated genes and risk factors.

Conclusions

In the current study, the Del allele of the HLA-G 14bp Indel polymorphism was positively associated with the risk of BP. The HLA-G gene encodes an important protein involved in the immune response, playing a significant role in viral infections. The Del allele is associated with lower levels of both HLA-G mRNA and circulating sHLA-G isoforms, potentially impairing the effectiveness of immune tolerance mechanisms. Further genetic association studies using case-control designs are needed to establish Indel polymorphisms as possible risk factors for bipolar disorder.

Declarations

Acknowledgement

The authors are indebted to the participants for their close cooperation.

Ethical statement

The procedures followed in this case-control study were approved by the Ethics Committee of Shiraz University in correspondence with the ethical guidelines of the Declaration of Helsinki (as revised in 2013). Informed consent was obtained from all participants before enrolled in this study.

Data sharing statement

No additional data or information is available for this paper.

Funding

None.

Conflict of interest

The authors declare no conflict of interests.

Authors’ contributions

Genotyping and data collection, data analysis, and paper writing (FZ), data interpretation (FZ, MS), study conception and design (MS). All authors have read and approved the final version of the manuscript.

References

  1. Grande I, Berk M, Birmaher B, Vieta E. Bipolar disorder. Lancet 2016;387(10027):1561–1572 View Article PubMed/NCBI
  2. Craddock N, Sklar P. Genetics of bipolar disorder. Lancet 2013;381(9878):1654–1662 View Article PubMed/NCBI
  3. Farmer A, Elkin A, McGuffin P. The genetics of bipolar affective disorder. Curr Opin Psychiatry 2007;20(1):8–12 View Article PubMed/NCBI
  4. Mills RE, Luttig CT, Larkins CE, Beauchamp A, Tsui C, Pittard WS, et al. An initial map of insertion and deletion (INDEL) variation in the human genome. Genome Res 2006;16(9):1182–1190 View Article PubMed/NCBI
  5. Mullaney JM, Mills RE, Pittard WS, Devine SE. Small insertions and deletions (INDELs) in human genomes. Hum Mol Genet 2010;19(R2):R131–R136 View Article PubMed/NCBI
  6. Auton A, Brooks LD, Durbin RM, Garrison EP, Kang HM, Korbel JO, et al. A global reference for human genetic variation. Nature 2015;526(7571):68–74 View Article PubMed/NCBI
  7. Du J, Lan J, Yang H, Ying Q, Huang G, Mou J, et al. Association of angiotensin-converting enzyme insertion/deletion (ACE I/D) gene polymorphism with susceptibility to prostate cancer: an updated meta-analysis. World J Surg Oncol 2022;20(1):354 View Article PubMed/NCBI
  8. Liu M, Yi J, Tang W. Association between angiotensin converting enzyme gene polymorphism and essential hypertension: A systematic review and meta-analysis. J Renin Angiotensin Aldosterone Syst 2021;22(1):1470320321995074 View Article PubMed/NCBI
  9. Huang T, Yan Y, Li J, Chen H, Chen Z. An insertion-deletion polymorphism in angiotensin-converting enzyme is associated with a reduced risk of preeclampsia: an evidence-based meta-analysis from 44 studies. Hypertens Pregnancy 2020;39(3):336–347 View Article PubMed/NCBI
  10. Dai J, Huang M, Amos CI, Hung RJ, Tardon A, Andrew A, et al. Genome-wide association study of INDELs identified four novel susceptibility loci associated with lung cancer risk. Int J Cancer 2020;146(10):2855–2864 View Article PubMed/NCBI
  11. Kordestanian N, Saadat M. A 50-bp Ins/Del polymorphism at the promoter region of the superoxide dismutase-1 and bipolar disorder type 1. Nord J Psychiatry 2017;71(8):570–573 View Article PubMed/NCBI
  12. Barbosa IG, Ferreira GC, Andrade Júnior DF, Januário CR, Belisário AR, Bauer ME, et al. The renin angiotensin system and bipolar disorder: A systematic review. Protein Pept Lett 2020;27(6):520–528 View Article PubMed/NCBI
  13. Kazemi-Noughabi M, Saadat I, Saadat M. Association between insertion/deletion polymorphism in intron 3 of XRCC4 and susceptibility to type I bipolar disorder. Psychiatr Genet 2016;26(1):52 View Article PubMed/NCBI
  14. Green EK, Rees E, Walters JT, Smith KG, Forty L, Grozeva D, et al. Copy number variation in bipolar disorder. Mol Psychiatry 2016;21(1):89–93 View Article PubMed/NCBI
  15. Debnath M, Busson M, Jamain S, Etain B, Hamdani N, Oliveira J, et al. The HLA-G low expressor genotype is associated with protection against bipolar disorder. Hum Immunol 2013;74(5):593–7 View Article PubMed/NCBI
  16. Sundaresh A, Wu CL, Chinnadurai RK, Rajkumar RP, Mariaselvam CM, LeMaoult J, et al. The HLA-G genetic contribution to bipolar disorder: A trans-ethnic replication. Immunol Invest 2018;47(6):593–604 View Article PubMed/NCBI
  17. Bordbar M, Saadat M. Association between 15 insertion/deletion genetic polymorphisms and risk of schizophrenia using pooled samples. EXCLI J 2023;22:310–314 View Article PubMed/NCBI
  18. Winham SJ, Cuellar-Barboza AB, McElroy SL, Oliveros A, Crow S, Colby CL, et al. Bipolar disorder with comorbid binge eating history: a genome-wide association study implicates APOB. J Affect Disord 2014;165:151–158 View Article PubMed/NCBI
  19. Stacey D, Benyamin B, Lee SH, Hyppönen E. A Metabolome-Wide Mendelian Randomization Study Identifies Dysregulated Arachidonic Acid Synthesis as a Potential Causal Risk Factor for Bipolar Disorder. Biol Psychiatry 2024 View Article PubMed/NCBI
  20. Yamamoto H, Lee-Okada HC, Ikeda M, Nakamura T, Saito T, Takata A, et al. GWAS-identified bipolar disorder risk allele in the FADS1/2 gene region links mood episodes and unsaturated fatty acid metabolism in mutant mice. Mol Psychiatry 2023;28(7):2848–2856 View Article PubMed/NCBI
  21. Ikeda M, Takahashi A, Kamatani Y, Okahisa Y, Kunugi H, Mori N, et al. A genome-wide association study identifies two novel susceptibility loci and trans population polygenicity associated with bipolar disorder. Mol Psychiatry 2018;23(3):639–647 View Article PubMed/NCBI
  22. Lee YH, Kim JH, Song GG. Pathway analysis of a genome-wide association study in schizophrenia. Gene 2013;525(1):107–15 View Article PubMed/NCBI
  23. Yan NE, Dimick MK, Kennedy KG, Zai CC, Kennedy JL, MacIntosh BJ, et al. Vascular endothelial growth factor polymorphism rs699947 is associated with neurostructural phenotypes in youth with bipolar disorder. J Child Adolesc Psychopharmacol 2023;33(6):243–254 View Article PubMed/NCBI
  24. Ates O, Celikel FC, Taycan SE, Sezer S, Karakus N. Association between 1603C>T polymorphism of DBH gene and bipolar disorder in a Turkish population. Gene 2013;519(2):356–9 View Article PubMed/NCBI
  25. Rees M, Norton N, Jones I, McCandless F, Scourfield J, Holmans P, et al. Association studies of bipolar disorder at the human serotonin transporter gene (hSERT; 5HTT). Mol Psychiatry 1997;2(5):398–402 View Article PubMed/NCBI
  26. Vincze I, Perroud N, Buresi C, Baud P, Bellivier F, Etain B, et al. Association between brain-derived neurotrophic factor gene and a severe form of bipolar disorder, but no interaction with the serotonin transporter gene. Bipolar Disord 2008;10(5):580–587 View Article PubMed/NCBI
  27. Van Den Bogaert A, Sleegers K, De Zutter S, Heyrman L, Norrback KF, Adolfsson R, et al. No allelic association or interaction of three known functional polymorphisms with bipolar disorder in a northern Swedish isolated population. Psychiatr Genet 2006;16(5):209–212 View Article PubMed/NCBI
  28. Aflouk Y, Inoubli O, Kenz A, Yacoub S, Zaafrane F, Gaha L, et al. Association between polymorphisms of TLR2-1-6 and bipolar disorder in a tunisian population. Mol Biol Rep 2023;50(11):8877–8888 View Article PubMed/NCBI
  29. Gigante AD, Andreazza AC, Lafer B, Yatham LN, Beasley CL, Young LT. Decreased mRNA expression of uncoupling protein 2, a mitochondrial proton transporter, in post-mortem prefrontal cortex from patients with bipolar disorder and schizophrenia. Neurosci Lett 2011;505(1):47–51 View Article PubMed/NCBI
  30. Köse Çinar R, Sönmez MB, Görgülü Y. Peripheral blood mRNA expressions of stress biomarkers in manic episode and subsequent remission. Psychoneuroendocrinology 2016;70:10–16 View Article PubMed/NCBI
  31. Yang J, Wu X, Huang J, Chen Z, Huang G, Guo X, et al. TP53 polymorphism contributes to the susceptibility to bipolar disorder but not to schizophrenia in the Chinese Han population. J Mol Neurosci 2019;68(4):679–687 View Article PubMed/NCBI
  32. Qi YJ, Lu YR, Shi LG, Demmers JAA, Bezstarosti K, Rijkers E, et al. Distinct proteomic profiles in prefrontal subareas of elderly major depressive disorder and bipolar disorder patients. Transl Psychiatry 2022;12(1):275 View Article PubMed/NCBI
  33. Guldiken G, Karayagmurlu A, Kucukgergin C, Coskun M. VEGF, IGF-1 and FGF-2 serum levels in children and adolescents with autism spectrum disorder with and without bipolar disorder. J Autism Dev Disord 2023 View Article PubMed/NCBI
  34. Berrettini W. Bipolar disorder and schizophrenia: not so distant relatives? World Psychiatry 2003;2(2):68–72 View Article PubMed/NCBI
  35. Berrettini WH. Are schizophrenic and bipolar disorders related? A review of family and molecular studies. Biol Psychiatry 2000;48(6):531–538 View Article PubMed/NCBI
  36. Bipolar Disorder and Schizophrenia Working Group of the Psychiatric Genomics Consortium. Genomic Dissection of Bipolar Disorder and Schizophrenia, Including 28 Subphenotypes. Cell 2018;173(7):1705–1715.e16 View Article PubMed/NCBI
  37. Mikhalitskaya EV, Vyalova NM, Ermakov EA, Levchuk LA, Simutkin GG, Bokhan NA, et al. Association of Single Nucleotide Polymorphisms of Cytokine Genes with Depression, Schizophrenia and Bipolar Disorder. Genes (Basel) 2023;14(7):1460 View Article PubMed/NCBI
  38. Meng X, Zheng JL, Sun ML, Lai HY, Wang BJ, Yao J, et al. Association between MTHFR (677C>T and 1298A>C) polymorphisms and psychiatric disorder: A meta-analysis. PLoS One 2022;17(7):e0271170 View Article PubMed/NCBI
  39. Andrews JL, Goodfellow FJ, Matosin N, Snelling MK, Newell KA, Huang XF, et al. Alterations of ubiquitin related proteins in the pathology and development of schizophrenia: Evidence from human and animal studies. J Psychiatr Res 2017;90:31–39 View Article PubMed/NCBI
  40. Saadat M, Qasemian-Talgard A, Darvishi FZ, Taghipour N, Saadat I. A new simple method for estimation of allelic frequencies using pooled samples. Gene 2019;703:13–16 View Article PubMed/NCBI
  41. Saadat M, Mohammadynejad P, Ghanizadeh A, Saadat I. Genetic polymorphisms (at codons 194 and 399) in the DNA repair gene XRCC1 and susceptibility to bipolar disorder. Psychiatry Res 2012;198(1):171 View Article PubMed/NCBI
  42. Rafiee L, Saadat I, Saadat M. Glutathione S-transferase genetic polymorphisms (GSTM1, GSTT1 and GSTO2) in three Iranian populations. Mol Biol Rep 2010;37:155–158 View Article PubMed/NCBI
  43. Nasseri G, Zahedi T, Mousavi-Kazerooni F, Saadat M. Prevalence of Null Genotypes of Glutathione S-Transferase T1 (GSTT1) and M1 (GSTM1) in Seven Iranian Populations. Iran J Public Health 2015;44(12):1655–1661 View Article PubMed/NCBI
  44. Molnar S, Mihanović M, Grah M, Kezić S, Filaković P, Degmecić D. Comparative study on gene tags of the neurotransmission system in schizophrenic and suicidal subjects. Coll Antropol 2010;34(4):1427–1432 View Article PubMed/NCBI
  45. Newton CR. Mutational analysis: known mutations. In: McPherson MJ, Hames BD, Taylor GR (eds). PCR2: A Practical Approach 1995:219–222 View Article PubMed/NCBI
  46. Beltrami S, Rizzo S, Strazzabosco G, Gentili V, Alogna A, Narducci M, et al. Non-classical HLA class I molecules and their potential role in viral infections. Hum Immunol 2023;84(8):384–392 View Article PubMed/NCBI
  47. Terayama H, Nishino Y, Kishi M, Ikuta K, Itoh M, Iwahashi K. Detection of anti-Borna Disease Virus (BDV) antibodies from patients with schizophrenia and mood disorders in Japan. Psychiatry Res 2003;120(2):201–6 View Article PubMed/NCBI
  48. Dickerson FB, Boronow JJ, Stallings C, Origoni AE, Cole S, Krivogorsky B, et al. Infection with herpes simplex virus type 1 is associated with cognitive deficits in bipolar disorder. Biol Psychiatry 2004;55(6):588–93 View Article PubMed/NCBI
  49. Hornig M, Briese T, Licinio J, Khabbaz RF, Altshuler LL, Potkin SG, et al. Absence of evidence for bornavirus infection in schizophrenia, bipolar disorder and major depressive disorder. Mol Psychiatry 2012;17(5):486–493 View Article PubMed/NCBI
  50. Figueiredo TC, de Oliveira JR. Reconsidering the association between the major histocompatibility complex and bipolar disorder. J Mol Neurosci 2012;47(1):26–30 View Article PubMed/NCBI
  51. Bauer ME, Teixeira AL. Neuroinflammation in Mood Disorders: Role of Regulatory Immune Cells. Neuroimmunomodulation 2021;28(3):99–107 View Article PubMed/NCBI
  52. Chen XY, Yan WH, Lin A, Xu HH, Zhang JG, Wang XX. The 14 bp deletion polymorphisms in HLA-G gene play an important role in the expression of soluble HLA-G in plasma. Tissue Antigens 2008;72(4):335–41 View Article PubMed/NCBI
  53. Boukouaci W, Busson M, Fortier C, Amokrane K, de Latour RP, Robin M, et al. Association of HLA-G low expressor genotype with severe acute graft-versus-host disease after sibling bone marrow transplantation. Front Immunol 2011;2:74 View Article PubMed/NCBI

About this Article

Cite this article
Zebarjad F, Saadat M. Association between 15 Insertion/Deletion Polymorphisms and the Risk of Type 1 Bipolar Disorder. Gene Expr. 2025;24(2):95-101. doi: 10.14218/GE.2023.00159.
Copy Export to RIS Export to EndNote
Article History
Received Revised Accepted Published
October 29, 2023 November 24, 2023 February 2, 2024 July 5, 2024
DOI http://dx.doi.org/10.14218/GE.2023.00159