Introduction
Hepatitis C virus (HCV) infection is a major cause of chronic hepatitis, liver cirrhosis and hepatocellular carcinoma, affecting approximately 71 million persons according to recent estimates.1 HCV therapy has been revolutionized with the introduction of direct-acting antiviral agents (commonly known as DAAs), which can achieve viral eradication in >95% of cases with minimal toxicity and overall good tolerability.2 However, the implementation of these approaches is complicated by the cost, potential for reinfection, generation of drug-resistant viruses, reactivation of other viruses, and end-stage liver disease progression that occurs even after virus clearance.3,4 HCV also remains the sole hepatitis virus for which a vaccine is not yet available. Thus, novel prophylactic and therapeutic approaches for HCV are still necessary. Identification of host factors involved in HCV replication is critical to understand the molecular mechanism of the viral life cycle, which has significant implications for the development of host-directed strategies to interrupt this cycle.
The ras-related nuclear (RAN) protein is a small GTP-binding protein belonging to the RAS superfamily. It has a well-established role in regulating the transport of macromolecules across the nuclear envelope5,6 and has also been implicated in mitotic spindle assembly, cell cycle progression, and nuclear envelope formation.7,8 In eukaryotic organisms, the active transport of macromolecules between the nucleus and cytoplasm is an essential cellular process.9 Dysregulated protein levels of RAN could cause aberrant nucleo-cytoplasmic transport of RNA and proteins, possibly leading to the initiation and progression of many diseases.
Cellular protein polypyrimidine tract-binding protein (PTB) has been shown to enhance HCV translation by binding to the 5′-untranslated region (UTR) and the 3′-end 98 nucleotides (X region) of HCV RNA.10–12 The immunodepletion of PTB could completely inhibit HCV translation.13 These results present evidence for the functional requirement of PTB during HCV translation initiation. In addition to the conserved X region of the 3′ UTR, PTB also binds to the poly(U) tract of the 3′UTR.14,15 And UV cross-linking studies showed that the PTB-5′-UTR binding was much weaker than the PTB-3′-UTR binding.16,17 The strong and preferential binding of PTB to the 3′ UTR suggests that it may be recruited to participate in the initiation of HCV RNA replication.17 The earlier work found that silencing of PTB by small interfering RNA (siRNA) substantially blocked HCV replication.18,19 And HCV RNA synthesis could be inhibited by anti-PTB antibody in a cell-free, de novo HCV RNA synthesis system.18 The direct evidence that PTB is required for HCV RNA replication is that PTB co-localizes with the viral replicase complex.20 These studies indicate that PTB is a part of the HCV RNA replication complex and participates in viral RNA synthesis. The above results together indicate that PTB has dual functions in HCV life cycle, including translation and RNA replication.
Our initial study showed that HCV infection significantly induced the expression of RAN. Additionally, infectious HCV cell culture systems have been developed, enabling further investigations of the molecular mechanism of HCV infection.21,22 Thus, this study was conducted to investigate the role and underlying mechanisms of RAN in HCV infection in an HCV cell culture system using a JC1-Luc chimeric virus.
Methods
Cell culture and virus plasmids
Human hepatoma Huh7.5.1 cells were grown at 37°C in a 5% carbon dioxide atmosphere with Dulbecco’s modified Eagle’s medium supplemented with 2 mM L-glutamine, 1 mM sodium pyruvate, 1× nonessential amino acids, 100 U/mL of penicillin, 100 µg/mL of streptomycin, and 10% fetal bovine serum. The plasmid pFL-JC1 was a kind gift from Apath (St. Louis, MO, USA). The chimeric full-length construct pFL-JC1 has been described elsewhere.21,23,24 To facilitate the detection of HCV infection, reporter viruses were constructed by inserting the firefly luciferase gene into the carboxyl-terminal region of NS5A in the JC1 genomes.23,25
RNA transfection, HCV infection, and titration
The production of infectious HCV in hepatocytes was performed as described previously. Briefly, Huh7.5.1 cells were mixed with in vitro-transcribed RNA and electroporated (Gene Pulser System; Bio-Rad Hercules, CA, USA) using a single square wave at 260 V and a 25-millisecond pulse length. The supernatant was harvested and concentrated using a centrifugal filter (Amicon 100K; Millipore, Billerica, MA, USA). Purified viruses were used for infection and titration.
HCV replication and treatment
Huh7.5.1 cells were seeded into 96-well plates at a density of 5×103 cells per well in 100 µL of medium. After incubating overnight for attachment, JC1-Luc virus was added to the wells. After 24 h, the medium was aspirated and replaced with 100 µL of complete medium, followed by an additional 48 h incubation. The HCV infection and RNA replication rates were quantified by measuring the luciferase activity using a microplate luminometer (Veritas microplate luminometer; Turner Biosystems, Sunnyvale, CA, USA).
Quantitative reverse transcription-PCR
Cells were collected by trypsinization, and the total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s protocol. cDNA was synthesized using the PrimeScript™ Reverse Transcription Reagent Kit with gDNA Eraser (Takara, Tokyo, Japan). The products were then used for analysis by the PRISM 7900 Sequence Detection System (Applied Biosystems Inc., Foster City, CA, USA) and the SYBR® Premix Ex Taq™ Kit (Takara). The samples were processed in triplicate and analyzed by the 2−ΔΔCt method. The primers were purchased from Sangon Biotech (Shanghai, China) and are listed in Table 1.
Table 1Primer sequences used in the study
 | Gene | Upstream primer (5′→3′) | Downstream primer (5′→3′) | 
|---|
| HCV | GCGTTAGTATGAGTGTCGTG | TCGCAAGCACCCTATCAG | 
| RAN | GTGAAGGCGAAATCCATTGT | TCCTAGCAAGCCAGAGGAAG | 
| GAPDH | GAAGGTGAAGGTCGGAGTC | GAAGATGGTGATGGGATTTC | 
Western blotting
Whole-cell extracts were prepared using RIPA lysis buffer containing the protease inhibitor PMSF. Additionally, the cytoplasmic and nuclear extracts from cells were extracted using the Nuclear and Cytoplasmic Extraction Reagents (Product No. 78835; ThermoFisher Scientific, Waltham, MA, USA). Equivalent amounts of protein (20 µg) were separated by 12% SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Millipore). The membrane was blocked in 5% nonfat milk in Tween 20 Tris-buffered saline and incubated with primary antibodies specific for HCV core protein (Abcam, Cambridge, UK), PTB (Abcam), RAN (Abcam), glyceraldehyde-3-phosphate dehydrogenase (GAPDH, a cytoplasmic protein marker; Cell Signaling Technology, Danvers, MA, USA) and proliferating cell nuclear Ag protein (PCNA, a nuclear protein marker; Cell Signaling Technology, Danvers, MA, USA) at 4°C overnight. After washing, the membrane was incubated with horseradish peroxidase-conjugated secondary antibodies (SouthernBiotech, Birmingham, AL, USA) for 1 h at room temperature (RT) and visualized with enhanced ECL (ThermoFisher Scientific) following exposure to X-ray films.
Immunofluorescence and confocal analysis
Huh7.5.1 cells plated on glass cover slips (BD Biosciences, San Jose, CA, USA) were infected with JC1-Luc virus for 24 h and then incubated with 100 µL of complete medium. The cells were harvested for immunofluorescence staining after 48 h of incubation. The cells were fixed in 4% paraformaldehyde for 30 m at RT, permeabilized in 0.5% Triton X-100/phosphate-buffered saline for 20 m, and then blocked in 1% bovine serum albumin in phosphate-buffered saline for 1 h at RT to minimize nonspecific adsorption of the antibodies. The cells were then incubated with primary antibodies (PTB or RAN: 1:100; Abcam) in 1% bovine serum albumin/Tween 20 Tris-buffered saline overnight at 4°C, followed by an additional incubation in Alexa fluor-conjugated secondary antibodies (1:500; Life Technologies, Gaithersburg, MD, USA) at RT for 1 h. The nucleus was stained with 4′,6′-diamidino-2- phenylindole dihydrochloride (commonly known as DAPI; Sigma-Aldrich, St. Louis, MO, USA), and then the cells were washed three times with phosphate-buffered saline. After the coverslips were mounted on glass slides with mounting medium, the glass slides were photographed using a confocal microscope (Olympus, Tokyo, Japan).
Protein-protein interaction analysis
For coimmunoprecipitation, the cells were lysed with Cell Lysis Buffer (1×; Cell Signaling Technology) containing 1 mM PMSF, 10 mM nicotinamide and 10 µM trichostatin A The lysed cells were centrifuged (13,000 × g, 4°C, 10 m), and the supernatants were used for immunoprecipitation. Next, 50 µL of fresh protein G magnetic beads (Millipore) was incubated with anti-RAN or anti-PTB for 10 m with continuous mixing at RT. The lysates (400 µg) and the immobilized capture antibody were then incubated at 4 °C under constant rotation overnight. The beads were washed three times with 1 mL of cold lysis buffer containing protease inhibitors. Finally, the beads were resuspended in 80 µL of 2× Laemmli sample buffer and heated to 95°C for 10 m. The beads were then centrifuged for 1 m at 1,000 × g, and the supernatant was collected and used for western blotting.
RNA interference
Small interfering (si)RNAs against human RAN (Ribobio, Guangzhou, China) and control scrambled siRNA (Ribobio, Guangzhou, China) were predesigned and synthesized. Huh7.5.1 cells (at 30% to 40% confluence) were transfected with 100 nM RAN siRNAs using the Lipofectamine® RNAiMAX Reagent (Invitrogen), according to the manufacturer’s protocol. Twenty-four hours after transfection, the cells were infected with JC1-Luc virus for 24 h and subsequently incubated with fresh medium for 48 h. The cells were then collected and lysed for luciferase assays, quantitative reverse transcription-PCR and western blotting. The sequences used here are listed in Table 2.
Table 2siRNA sequences used in the study
 | siRNAs | Sense, 5′→3′ | Antisense, 5′→3′ | 
|---|
| 003 | ACAGGAAAGUGAAGGCGAA dTdT | dTdT UGUCCUUUCACUUCCGCUU | 
| 004 | GACCUUCGUGAAACGUCAU dTdT | dTdT CUGGAAGCACUUUGCAGUA | 
| 005 | GUAUGUAGCCACCUUGGGU dTdT | dTdT CAUACAUCGGUGGAACCCA | 
Data analysis
All the data were processed using SPSS 19.0 software and presented as mean ± standard error. Analysis of variance (commonly known as ANOVA) and the least significant difference test were used for comparisons among the groups. When the data were not normally distributed, the Mann-Whitney U test and Kruskal-Wallis test were used. A p-value less than 0.05 was considered significant.
Results
HCV infection induces RAN expression and cytoplasmic redistribution of PTB
After Huh7.5.1 cells were infected with the JC1-Luc virus, the HCV infection and replication efficiencies were analyzed using the luciferase assay and western blotting. The luciferase activity and core protein expression levels were markedly increased when the cells were infected with the JC1-Luc virus (p<0.01; Fig. 1A, B, D) compared with the control group. RAN expression was also examined by quantitative reverse transcription-PCR and western blotting. JC1 virus infection substantially induced the RAN expression compared with the control (p<0.01; Fig. 1B–D).
As mentioned above, studies have shown that PTB binds to HCV RNA at several different sites and participates in viral replication or translation. The cytoplasmic translocation of PTB was determined by western blotting in our study. The results revealed that PTB was predominantly localized in the nucleus in the absence of HCV infection; however, strong cytoplasmic accumulation of PTB was observed following HCV stimulation (Fig. 2A, C; p<0.01). The distribution of PTB in HCV-infected cells was also evaluated by immunofluorescence assay. The cytoplasmic distribution of PTB was identified when cells were infected with the JC1-Luc virus (Fig. 2B). These data together illustrated that HCV infection induced the cytoplasmic accumulation of PTB.
Knockdown of RAN inhibits HCV infection and cytoplasmic accumulation of PTB
The silencing effects of siRNAs on the mRNA and protein expression levels of RAN were evaluated using quantitative reverse transcription-PCR and western blotting. Compared with the MOCK-treated group, the RAN mRNA and protein levels in RAN siRNA-treated cells were significantly decreased (p<0.01; Fig. 3). Inhibition of the replication of HCV was measured using the luciferase assay, quantitative reverse transcription-PCR and western blotting. The luciferase activity and both HCV RNA and core protein expression levels were dramatically inhibited by RAN siRNA (p<0.01; Fig. 4A–C) compared with the MOCK-treated group. Additionally, the cytoplasmic accumulation of PTB in the RAN-silenced group was significantly decreased (Fig. 4D, E).
RAN colocalizes with PTB
To verify whether RAN colocalizes with PTB, the subcellular localization of RAN and PTB were evaluated by immunofluorescence staining with anti-RAN (red) and anti-PTB (green) antibodies in Huh7.5.1 cells infected with the JC1 virus. The merged image in yellow indicates the combination of PTB fluorescence intensity with the RAN fluorescence intensity. PTB and RAN staining was mainly distributed in the nucleus of Huh7.5.1 cells, but strong cytoplasmic RAN and PTB immunofluorescence was identified when cells were infected with the JC1 virus (Fig. 5). Additionally, double-labeling of RAN and PTB was observed in both the cytoplasm and nucleus. The above results revealed that HCV infection induces the cytoplasmic distribution of RAN and PTB and RAN colocalizes with PTB.
RAN directly interacts with PTB
We investigated the potential crosstalk between RAN and PTB in Huh7.5.1 cells. Therefore, endogenous protein-protein interaction in cells was examined by co-immunoprecipitation experiments using anti-RAN and anti-PTB antibodies. Cells were extracted and immunoprecipitated with anti-RAN antibody, and the immune complexes were analyzed by western blotting with the anti-PTB antibody. RAN interacted with PTB in Huh7.5.1 cells (Fig. 6), confirming their crosstalk.
Discussion
RAN is a critical player in nucleo-cytoplasmic transport that is mainly localized in the nucleus and cycles between the GDP-bound inactive and GTP-bound active state.26 It is now well established that RAN plays an important role in cancer development and progression.27,28 It is overexpressed in various cancers and correlated with increased aggressiveness of the cancer cells in vitro and in vivo.29–31 Recent studies have indicated that RAN also plays an important role in virus infection. A study showed that the microRNA miR-134 regulated poliovirus replication via the modulation of RAN.32 Additionally, the reduced production of RAN by RNA interference markedly reduced the synthesis of EV71-encoded viral proteins and virus titers.33 However, the role of RAN in HCV infection remained unclear.
The above data prompted us to investigate the function of RAN in the regulation of HCV infection. Our results showed that HCV infection significantly induced RAN expression. Additionally, the knockdown of RAN expression with siRNAs significantly reduced HCV replication. RAN silencing has been shown to cause aberrant nucleo-cytoplasmic transport of tumor suppressors and oncogenes, possibly leading to the initiation of cancer.34 Because RAN plays a key role in controlling nucleo-cytoplasmic trafficking, we hypothesized that HCV-induced upregulation of RAN expression might be involved in the development of HCV by influencing the essential viral proteins or host proteins for viral replication.
PTB is primarily localized in the nucleus. However, it can shuttle from the nucleus to the cytoplasm in response to specific signals, such as viral infection.25 As a ubiquitous RNA-binding protein, PTB can function as both a repressor and activator of RNA metabolism by restructuring RNA to promote or inhibit the binding of other factors, processes known to be important for the life cycle of many viruses.35 The necessity of PTB for HCV replication and translation has been proposed. Studies have shown that the recognition of the 3′-UTR by PTB was necessary for the efficient replication of HCV RNA.14,18,36 Other studies have also indicated that the interaction of PTB with the 5′-UTR and 3′-UTR of the HCV RNA was required for the initiation of translation.12,13
Our previous results indicated that the cytoplasmic accumulation of PTB was directly associated with HCV replication, and blocking the cytoplasmic redistribution of PTB could inhibit HCV replication.37 However, the mechanism of nucleo-cytoplasmic translocation of PTB is not clear. As the major cellular function of RAN is to regulate nucleo-cytoplasmic transport of molecules through the nuclear pore complex, we consider that RAN might interact with PTB and facilitate its nucleo-cytoplasmic translocation.
Based on the above research assumptions, our research continued and found that increased nucleo-cytoplasmic translocation of PTB in response to HCV infection was dramatically inhibited by RAN silencing. RAN interacted with PTB, as demonstrated by coimmunoprecipitation studies, and facilitated its nucleo-cytoplasmic translocation. Because PTB in the host cytoplasm is directly associated with HCV replication, the involvement of RAN in HCV replication can be the result of the cytoplasmic accumulation of PTB.
Conclusions
In summary, our results demonstrate that the involvement of RAN in HCV infection is mediated by interacting with PTB and then influencing the cytoplasmic translocation of PTB. Our work uncovers a new mechanism responsible for host cellular factors involved in HCV infection and indicates that targeting of the nucleo-cytoplasmic translocation of the host PTB protein could be a novel strategy against HCV. Antiviral agents acting through this mechanism might inhibit viral infection with no or a decreased chance of drug-resistant mutations. Ideally, the combination of a RAN suppressor with known anti-HCV drugs might provide a variety of drug regimens that are appropriate for different patients and provide the potential advantage for preventing or decreasing drug-resistant mutations.
Abbreviations
- ANOVA: 
 analysis of variance
- DAAs: 
 direct-acting antiviral agents
- DAPI: 
 4′,6′-diamidino-2-phenylindole dihydrochloride
- GAPDH: 
 glyceraldehyde-3-phosphate dehydrogenase
- HCV: 
 hepatitis C virus
- UTR: 
 untranslated region
- PTB: 
 polypyrimidine tract-binding protein
- RAN: 
 ras-related nuclear protein
- RT: 
 room temperature
- si: 
 small interfering
Declarations
Acknowledgement
We thank Professor Zhi Chen (Zhejiang University, Hangzhou, China) for technical support.
Data sharing statement
All data are available upon request.
Funding
The work was supported by the Anhui Provincial Natural Science Foundation (1608085QH172), States S&T Projects of 13th Five Year (2018ZX10302206), Chinese Foundation for Hepatitis Prevention and Control (TQGB20200151, TQGB20180367), and Anhui Key Program of Medical Scientific Research of China (#2010A010).
Conflict of interest
The authors have no conflict of interests related to this publication.
Authors’ contributions
Study concept and design (JL, YG), acquisition of data (JX, JC), analysis and interpretation of data (JX, XM), drafting of the manuscript (JX, YS), critical revision of the manuscript for important intellectual content (XM, JC), administrative, technical, or material support, and study supervision (HY).