Introduction
Radiation injury is a common health threat, caused by factors such as radiation therapy, nuclear accidents, and radiological terrorist attacks. Radiation injury refers to a series of pathological changes and physiological dysfunctions that occur in humans or other organisms after exposure to or contamination by radioactive substances (such as X-rays, gamma rays, and radioactive isotopes). This issue endangers human health by causing complex and multifaceted damage to cells and tissues.1 The primary mechanisms of radiation injury include the ionization or excitation of electrons within atoms or molecules by radioactive substances, triggering a series of biochemical reactions that lead to DNA, protein, and lipid damage. This damage results in gene mutations, inflammatory responses,2 and immune function impairment. These changes can subsequently cause various diseases, including leukemia, tumors, immune system damage,3 and reproductive system injuries.4 Currently, finding effective treatments and drugs to mitigate the harm of radiation injury is an important research topic in radiomedicine.
In recent years, the research field of natural products as anti-radiation injury drugs has garnered significant attention. licorice (Glycyrrhiza uralensis Fisch.) is a common herb widely used in traditional Chinese medicine and as a food additive.5–7 Licochalcone B (Lico B), primarily found in the roots of licorice,8 is one of the main active components of licorice, exhibiting various pharmacological activities and biological effects such as antioxidant, anti-inflammatory, antiviral, antitumor, and immunomodulatory properties.9 Studies have shown that Lico B can reduce oxidative stress-induced cellular damage by inhibiting the production and scavenging of reactive oxygen species.10 Lico B can also inhibit inflammatory responses by reducing the release of inflammatory mediators and the infiltration of inflammatory cells, thereby alleviating symptoms of inflammation-related diseases.11–13 Additionally, Lico B possesses antiviral activity, capable of inhibiting viral replication and spread, showing potential for treating viral infections.14–16 Moreover, Lico B has demonstrated antitumor activity, inhibiting the proliferation and invasion of tumor cells and promoting tumor cell apoptosis.17 Recent research has also found that Lico B can modulate immune system functions, enhancing the body’s immunity.18 Due to its multiple biological activities and pharmacological effects, Lico B holds broad potential applications in the medical field.19
Radiation injury often leads to DNA damage, the production of excessive reactive oxygen species, and excessive inflammatory responses in the body. Whether Lico B can provide protection against radiation injury by reducing DNA damage, eliminating reactive oxygen species, and inhibiting inflammatory responses has not been reported so far. In this study, the protective effects of Lico B against radiation injury were investigated using cell and mouse models to provide a theoretical basis for its application in the treatment of radiation injury.
Materials and methods
Reagents and Instruments
Lico B (HY-N0373) was purchased from MedChemExpress. Dulbecco’s Modified Eagle Medium (DMEM; Gibco, 04242), DMEM/F12 Medium (Gibco, 01503), RPMI Medium 1640 (Gibco, 01351), and fetal bovine serum (FBS; Gibco, FND500) were obtained from Gibco (CA, USA). Penicillin-streptomycin was sourced from M&C GENE TECHNOLOGY (BEIJING) LTD (Beijing, China). Glutathione (GSH) Assay Kit (Beyotime, S0053), DNA Damage Detection Kit (γ-H2AX Immunofluorescence Method; Beyotime, C2035S), Cell Counting Kit-8 (CCK-8) Assay Kit (Bimake, C6005M), RNA Rapid Extraction Kit (Shanghai Yishan Biotechnology Co., Ltd., RN001), Fast Reverse Transcription Kit (Shanghai Yishan Biotechnology Co., Ltd., RT001), Hieff UNICON® Universal Blue quantitative polymerase chain reaction (qPCR) SYBR Green Master Mix (Shanghai Yeasen Biotechnology Co., Ltd., 11201ES08), and qPCR Primers (synthesized by Beijing Tianyi Huiyuan Biotechnology Co., Ltd.) were used. Cell culture consumables were provided by Corning. The Varioskan Flash Microplate Reader was purchased from Thermo (MA, USA), the 7500 Fast Real-time PCR System from ABI (CA, USA), the Power Pac164-5050 Electrophoresis Apparatus from Bio-Rad (CA, USA), the Tanon5200 Automatic Chemiluminescence Imaging System from Shanghai Tianneng (Shanghai, China), and the R2000 X-ray Irradiator from Rad Source (GE, USA).
Animals
Sixty C57BL/eight male mice, Specific pathogen free grade, aged six to eight weeks and weighing 18–22 g, were purchased from SPF Biotechnology Co., Ltd. This study was conducted in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals. The protocol was approved by the Experimental Animal Management and Use Committee of the Academy of Military Medical Sciences (Animal Ethics Approval Number: AMMSLAC-S-FT054-V3.0-R01). All surgical procedures were carried out under sodium pentobarbital anesthesia, and every effort was made to minimize suffering.
Cell preparation and irradiation
Human Epidermal Cell Lines HaCaT cells were generously provided by Professor Wenxia Zhou’s laboratory at the Academy of Military Medical Sciences. Human monocyte-macrophage cell lines THP-1 and RAW 264.7 cells were obtained from the frozen cell stocks of the Experimental Hematology and Biochemistry Laboratory, Institute of Radiation Medicine, Academy of Military Medical Sciences. The study complied with the ethical requirements of the Academy of Military Medical Sciences. THP-1 cells were cultured in RPMI 1640 medium (containing 10% FBS and 1% penicillin-streptomycin) and induced to differentiate into macrophages using 100 nmol/L phorbol-12-myristate-13-acetate (PMA).20 HaCaT cells were cultured in DMEM/F12 complete medium containing 10% FBS and 1% penicillin-streptomycin, with passaging every two to three days. RAW 264.7 cells were cultured in DMEM supplemented with 10% FBS and 1% penicillin-streptomycin. Cells were maintained in a cell culture incubator at 37°C with 5% CO2, with media changes every two to three days. Experimental groups included: control group, irradiation group, irradiation + Lico B 20 µmol/L group, and irradiation + Lico B 40 µmol/L group. HaCaT cells were seeded at 5 × 104 cells/mL, RAW 264.7 cells at 5 × 105 cells/mL, and THP-1 cells at 1.2 × 106 cells/mL in culture plates and incubated overnight. Cells were treated with Lico B for 2 h and then exposed to X-ray/γ-ray irradiation. The irradiation dose was 10 Gray (Gy), with an X-ray dose rate of 1.175 Gy/m and a γ-ray dose rate of 68.47 R/m. Culture dishes were returned to the incubator, and cells were cultured for an additional 2 h at 37°C with 5% CO2 after irradiation. Cells were then collected for analysis of DNA damage, intracellular GSH, and RNA extraction for gene expression analysis. Irradiation experiments were conducted in compliance with radiation safety regulations and under the guidance of professionals. The experimental protocol was conducted according to guidelines approved by the Academy of Military Medical Sciences.
Cell proliferation assay
The CCK-8 assay kit was used to measure the proliferation of HaCaT cells under different doses of X-ray irradiation (10 Gy, 20 Gy) at various time points (0 h, 24 h, 48 h, 72 h, 96 h).21 The culture medium was removed from the treated cells in a 96-well plate, and 100 µL of CCK-8 reaction solution (CCK-8 reagent: DMEM/F12 = 1:9) was added to each well, following the kit instructions. The cells were then incubated in a cell culture incubator for 2 h, and absorbance at 450 nm was measured. Cell proliferation activity was calculated using the formula: A450nm value of the experimental group - A450nm value of the blank control group.22
DNA damage detection
The DNA damage detection kit (phosphorylated histone H2AX (γ-H2AX) immunofluorescence method) was used to assess DNA double-strand breaks in cells. According to the kit instructions, cells were fixed with a fixative, permeabilized with a wash buffer, and incubated with a specific anti-γ-H2AX antibody. After washing with wash buffer to remove unbound antibodies, the cells were incubated with a fluorescently labeled anti-rabbit 488 secondary antibody. The cells were washed again with wash buffer to remove unbound secondary antibodies. The labeled cells were then observed under a fluorescence microscope for imaging and fluorescence quantitative analysis.
GSH detection
GSH and oxidized glutathione (GSSG) are crucial redox pairs within cells. Following the assay kit instructions, GSH and GSSG were detected. Cells were washed with PBS buffer, digested with the digestive solution for 2 m, and centrifuged to collect the cells, discarding the supernatant. The cell pellet was resuspended in three times the volume of the protein removal reagent and thoroughly vortexed. The samples underwent two rapid freeze-thaw cycles using liquid nitrogen and a 37°C water bath, followed by incubation on ice or at 4°C for 5 m. The samples were then centrifuged at 10,000 g for 10 m at 4°C, and the supernatant was used for total glutathione measurement. For the prepared samples, a dilution of GSH removal auxiliary solution was added at a ratio of 20 µL per 100 µL of sample and vortexed immediately. Next, GSH removal reagent working solution was added at a ratio of 4 µL per 100 µL of sample and vortexed immediately, followed by a 60-m reaction at 25°C. This reaction can remove up to 50 µmol/L of GSH; if the GSH content in the sample is too high, the sample needs to be appropriately diluted before the GSH removal operation. The treated samples were used for subsequent measurements. Absorbance was measured once after a 25-m reaction, using a single-point measurement method. A standard curve was plotted based on the absorbance of different concentration standards. The total glutathione or oxidized glutathione content was calculated by comparing the sample absorbance to the standard curve (GSSG concentration obtained from the standard curve multiplied by 2). GSH = Total Glutathione - GSSG×2.
qPCR detection of gene expression
To detect mRNA of inflammatory cytokines using qPCR, the following steps were performed: Cell collection: Cells from treated six-well plates were collected, and the supernatant was aspirated. The cells were washed twice with PBS. RNA extraction: Total RNA was purified using an RNA extraction kit, following the kit instructions. Reverse transcription: The extracted total RNA was reverse transcribed into cDNA using reverse transcriptase and primers, as per the kit instructions. qRT-PCR: qRT-PCR was performed to detect the mRNA expression of inflammation-related factors interleukin (IL)-1β, IL-1α, Caspase-1, tumor necrosis factor (TNF) -α, IL-18, IL-6; matrix metalloproteinases (MMP) 1 and 9; guanosine triphosphate cyclohydrolase 1 (GCH1); and amino acid transporter - solute carrier family 7 member 11 (SLC7A11). Primer sequences are listed in Table 1. PCR reaction setup: A 20 µL reaction system was prepared in a PCR reaction tube, including 0.2 µL of cDNA template, 0.8 µL of forward and reverse primers each, 10 µL of Hieff UNICON® Universal Blue qPCR SYBR Green Master Mix, and an appropriate amount of RNase-free water. PCR reaction program: The PCR reaction program was set on an ABI Prism 7500 Fast instrument, with a pre-denaturation step at 95°C for 30 s, denaturation at 95°C for 5 s, and annealing and extension at 60°C for 30 s, for a total of 40 cycles. The melting curve program was set according to the instrument’s instructions. Housekeeping gene and data analysis: The human β-Actin gene was used as the housekeeping gene. Target gene expression levels were calculated using the 2−ΔΔCt method.
Table 1Primer sequences of qPCR
| Gene name | Primer sequences (5′-3′) |
|---|
| β-Actin | F: TCT CCC AAG TCC ACA CAG G R: GGC ACG AAG GCT CAT CA |
| Caspase-1 | F: TTTCCGCAAGGTTCGATTTTCA R: GGCATCTGCGCTCTACCATC |
| IL-1β | F: ATGATGGCTTATTACAGTGGCAA R: GTCGGAGATTCGTAGCTGGA |
| IL-1α | F: TGGTAGTAGCAACCAACGGGA R: ACTTTGATTGAGGGCGTCATTC |
| TNF-α | F: CCTCTCTCTAATCAGCCCTCTG R: GAGGACCTGGGAGTAGATGAG |
| IL-18 | F: TCTTCATTGACCAAGGAAATCGG R: TCCGGGGTGCATTATCTCTAC |
| IL-6 | F: ACTCACCTCTTCAGAACGAATTG R: CCATCTTTGGAAGGTTCAGGTTG |
| MMP-1 | F: AAAATTACACGCCAGATTTGCC R: GGTGTGACATTACTCCAGAGTTG |
| MMP-9 | F: TGTACCGCTATGGTTACACTCG R: GGCAGGGACAGTTGCTTCT |
| GCH1 | F: ACGAGCTGAACCTCCCTAAC R: GAACCAAGTGATGCTCACACA |
| SLC7A11 | F: TCTCCAAAGGAGGTTACCTGC R: AGACTCCCCTCAGTAAAGTGAC |
Protection of Lico B on lethal irradiation in mice
Experiment 1: Eight-week-old male C57BL/six mice were randomly divided into three groups, with 10 mice in each: normal group, model group, and experimental group. The mice in the experimental group were given intraperitoneal injections of Lico B (40 mg/kg), while the mice in the normal and model groups received injections of an equal volume of solvent (5% dimethyl sulfoxide, 5% Tween 80, and saline). Animals were administered injections once daily before γ-ray irradiation. The mice in the model and experimental groups were then exposed to total-body γ-ray irradiation at a dose of 8 Gy. After irradiation, the mice continued to receive drugs or solvent for an additional two days. The number of deaths and the survival status of the mice were monitored for 20 consecutive days, and the survival curve was plotted using the Kaplan-Meier method.23
Experiment 2: All procedures were the same as in experiment 1, except that the mice in the experimental group were exposed to a combined dose of 6 Gy + 8 Gy γ-rays.24–26
Statistical analysis
Data were represented as mean plus or minus the standard error of the mean (mean ± SEM). For comparisons among multiple groups, one-way analysis of variance with Dunnett’s post-hoc test was used (GraphPad Prism, USA). The log-rank test was used for survival analysis. P < 0.05 was considered statistically significant.23
Results
Lico B promotes cell proliferation
The results of cell proliferation indicated that the growth of HaCaT cells was significantly inhibited after X-ray irradiation. However, compared to the irradiation group, the inhibitory effect on cell proliferation was markedly reduced in the Lico B group (Fig. 1a, b). This suggests that Lico B can mitigate the damaging effects of radiation on HaCaT cell proliferative capacity, thereby playing a protective role against radiation.
Lico B reduces DNA damage
γH2AX is a marker of DNA damage and repair, with increased levels reflecting the extent of DNA damage.27 After irradiation, γH2AX levels were elevated in both HaCaT cells and THP-1 cells, with a more pronounced increase observed in THP-1 cells. However, in the Lico B treatment group, γH2AX levels were significantly reduced in both HaCaT cells (Fig. 2a, b) and THP-1 cells (Fig. 2c, d), showing a dose-dependent effect. These results indicate that Lico B treatment effectively reduces radiation-induced DNA double-strand breaks.
Lico B enhances cellular antioxidant capacity
GSH is an important intracellular antioxidant that plays a crucial role in protecting cells from oxidative stress-induced damage.28 When cells are exposed to oxidative stress, GSH captures and neutralizes free radicals, protecting DNA, proteins, and lipids from oxidative damage. Under normal conditions, the ratio of GSH to its oxidized form GSSG is high, maintaining a reductive environment within the cell. However, under oxidative stress conditions, GSH is oxidized to GSSG, leading to a decrease in the GSH/GSSG ratio. In this irradiation experiment, both the GSH content and the GSH/GSSG ratio in RAW 264.7 cells significantly decreased after irradiation. In contrast, after Lico B treatment, the GSH content and the GSH/GSSG ratio in cells were significantly increased compared to the irradiation group, showing dose dependency (Fig. 3a, b).
Lico B reduces the expression of cellular inflammatory factors
Caspase-1 is a key molecule in inflammasome activation. Its upregulation participates in inflammasome activation and the production of pro-inflammatory cytokines such as IL-1β and IL-18. Apoptosis-associated speck-like protein containing a CARD (ASC) acts as an adaptor protein, linking the nucleotide oligomerization domain-like receptor family, pyrin domain-containing protein 3, and Caspase-1, thus being involved in inflammasome assembly. Cytokines such as IL-1α, IL-1β, IL-18, TNF-α, and IL-6 play significant roles in immune regulation and inflammatory responses. In this irradiation experiment, these inflammatory factors in THP-1 cells significantly increased after X-ray irradiation. However, after Lico B treatment, the levels of IL-1β, IL-18, Caspase-1, and TNF-α were significantly reduced (Fig. 4a–d). Similarly, after X-ray irradiation, these inflammatory factors in HaCaT cells significantly increased, but Lico B treatment significantly reduced the levels of IL-1β, IL-18, Caspase-1, TNF-α, and IL-6 (Fig. 5a–e). Additionally, after γ-ray irradiation, HaCaT cells also showed an increase in the expression of inflammatory factors, while Lico B treatment significantly reduced the levels of IL-1α, IL-1β, and IL-6 (Fig. 5f–h). These results suggest that Lico B alleviated radiation-induced inflammatory responses.
Lico B reduces the expression of matrix metalloproteinases
MMP-1 and MMP-9 belong to the matrix metalloproteinase family, which is involved in the degradation of the extracellular matrix.29 They play crucial roles in DNA damage repair and inflammatory responses. Radiation-induced DNA damage and inflammatory responses led to increased gene expression and activity of MMP-1 and MMP-9. However, after administration of Lico B, the expression levels of MMP-1 and MMP-9 were significantly reduced (Fig. 6a, b), which could be attributed to the anti-inflammatory and antioxidant properties of Lico B.
Lico B promotes the expression of GCH1
GCH1 is a key enzyme in the synthesis of tetrahydrobiopterin (BH4), which is involved in biopterin synthesis in organisms. A decrease in GCH1 activity reduces BH4 production, causing the uncoupling of nitric oxide synthase and leading to increased levels of Reactive Oxygen Species. Studies have found that radiation therapy can reduce GCH1 expression, possibly due to cell and DNA damage caused by radiation, which in turn affects the transcription and expression of the GCH1 gene.30,31 In this study, radiation led to reduced GCH1 expression, but after administration of Lico B, GCH1 expression significantly increased (Fig. 6c).
Lico B promotes the expression of amino acid transporters
SLC7A11 is an amino acid transporter involved in intracellular glutathione metabolism.32 This study found that the expression of SLC7A11 was reduced in HaCaT cells after irradiation, while administration of Lico B significantly promoted the expression of SLC7A11 (Fig. 6d). A consistent phenomenon was also observed in HAEC cells (Fig. 6e). These findings indicate the important role of Lico B in regulating the intracellular and extracellular GSH balance to counter oxidative stress by regulating the expression of SLC7A11. Additionally, the cytotoxicity of Lico B was evaluated, and the results showed that it did not exhibit any cytotoxicity at concentrations up to 80 µmol/L (Fig. 6f).
Lico B increases the survival rate of mice induced by radiation
The study results showed that Lico B treatment significantly increased the survival time of mice treated with γ-ray radiation. Statistical analysis revealed that, compared to the model group, the experimental group of mice exhibited longer survival times whether they received a solo 8 Gy radiation (Fig. 7a) or combined 6 Gy + 8 Gy irradiation (Fig. 7b). In the model group subjected to 8 Gy irradiation, all mice died within 10 days after irradiation. However, in the model group that received combined 6 Gy + 8 Gy irradiation, no mouse deaths were observed by day 10 after treatment with 6 Gy of irradiation, and after an additional 8 Gy of irradiation on day 11, all mice died within six days. These results indicate that Lico B had a protective effect against γ-ray irradiation-induced lethality in mice.
Discussion
Radiation-induced damage poses a serious health threat, particularly in the context of nuclear accidents, radiotherapy, or radiological terrorism. Radiation can cause cellular DNA damage, tissue inflammation, and apoptosis, ultimately leading to organ dysfunction and life-threatening consequences.33,34 The current scarcity of radioprotective drugs presents challenges for clinical treatment. Common methods for managing radiation damage include removing radioactive substances, symptomatic treatment, bone marrow transplantation, growth factor therapy, and radiation therapy.35 However, these treatments may have side effects, such as immunosuppression, increased risk of infection, and organ damage.36,37 Consequently, there is an urgent need to explore new treatment methods and drugs. Current research directions include developing small molecule drugs from traditional Chinese medicine, stem cell therapy, gene editing technology to repair damaged cells, and using biomaterials to promote tissue regeneration. Advances in these areas are expected to lead to breakthroughs in treating radiation damage, providing safer and more effective options for patients.
In this study, we investigated the protective effects of Lico B against radiation using cell and mouse models. We found that Lico B significantly alleviated radiation-induced cellular damage and inflammatory responses, reduced DNA damage, restored immune function, and improved radiation damage in vivo, extending the survival time of irradiated mice. These findings highlight the potential application of Lico B in radiation protection and treatment.
Radiation is a common carcinogen and teratogen that causes both direct and indirect damage to DNA.38 DNA damage can lead to halted cell division and growth, as well as difficulties in repairing damaged DNA.39 Failure to repair DNA damage can result in cell death, mutations, and radiation-induced tumor formation. Therefore, reducing DNA damage is crucial for protecting the body from radiation damage.40 Lico B promoted cell proliferation following radiation exposure, which aids in cell repair and proliferation.
Further mechanistic studies revealed that Lico B reduced DNA damage by inhibiting the expression of γH2AX, thereby offering additional protection against radiation damage. DNA damage can lead to mutations in cellular genetic material, affecting normal cell function and proliferation. Our study found that Lico B alleviated radiation-induced DNA damage through several pathways. First, Lico B exhibited antioxidant properties by promoting the synthesis of intracellular GSH, enhancing the synthesis of SLC7A11 to balance intracellular and extracellular GSH levels, and scavenging free radicals. Reducing oxidative stress after Lico B treatment was crucial for minimizing radiation-induced oxidative stress and cellular damage. Second, Lico B inhibited the inflammatory response following DNA damage, thereby reducing inflammation-induced cellular damage. Additionally, Lico B promoted DNA repair by regulating the expression of DNA repair-related genes, thereby decreasing the accumulation of damage. Consequently, Lico B maintained DNA stability and integrity by regulating GSH levels, enhancing GSH synthesis, inhibiting inflammation following DNA damage, and promoting the DNA repair process.
Oxidative stress is a significant mechanism of radiation damage. Lico B alleviated radiation-induced oxidative stress and cellular damage through multiple pathways. Lico B promoted the synthesis of intracellular GSH, enhanced the synthesis of GCH1 and BH4, balanced intracellular and extracellular GSH levels, and scavenged free radicals. GSH is a major intracellular antioxidant that neutralizes oxygen free radicals and reduces oxidative stress damage. Studies showed that during ferroptosis, intracellular iron overload increased oxidative stress, resulting in cellular damage and death.41 The expression level of SLC7A11 is closely related to intracellular GSH levels; low expression of SLC7A11 can decrease intracellular GSH levels, increasing cellular sensitivity to oxidative stress. Our study found that Lico B increased GSH synthesis by enhancing the expression of SLC7A11, thereby reducing radiation-induced oxidative stress. This mechanism may be a crucial pathway through which Lico B protects cells from radiation damage.
Radiation-induced inflammatory responses are another important mechanism of radiation damage.42,43 Radiation can trigger cellular inflammatory responses by activating the production of cytokines and chemokines, leading to cellular and tissue damage. Our study demonstrated that Lico B significantly reduced radiation-induced inflammatory responses by inhibiting the expression of inflammation-related genes, such as Caspase-1, IL-1β, IL-1α, TNF-α, IL-18, and IL-6. Additionally, Lico B inhibited the expression of matrix metalloproteinases (MMP-1/MMP-9), proteases associated with tissue damage and inflammation. This further supports the protective role of Lico B against radiation-induced tissue injury. By alleviating radiation-induced inflammatory responses, Lico B further reduced cellular and tissue damage, which could be a key mechanism of its radioprotective effect.
The type and dose of radiation significantly impact radiation damage. X-rays and γ-rays are common types of radiation that can cause damage. Our study utilized these two radiation sources to evaluate the protective effect of Lico B. The results showed that Lico B exhibited significant protective effects in models of both X-ray and γ-ray radiation-induced damage, indicating its broad-spectrum radioprotective effect.44,45
In animal models, we further confirmed the radioprotective effect of Lico B in vivo. First, Lico B-treated mice showed a significantly improved survival rate after receiving a lethal dose of radiation. Additionally, a higher survival rate was observed in mice irradiated with the combined dose of 6 Gy + 8 Gy compared with the model group. The doses of 8 Gy and the combined dose of 6 Gy + 8 Gy had different effects on mouse survival. A single dose of 8 Gy is lethal, with all mice dying within 10 days of exposure. In contrast, the combined dose involving an initial non-lethal 6 Gy dose followed by a lethal 8 Gy dose resulted in all mice dying within six days after the second irradiation. This indicates the cumulative and additive effects of radiation on the body, meaning that the initial 6 Gy dose followed by the 8 Gy dose increased the mice’s sensitivity to radiation, leading to quicker mortality. Lico B treatment provided significant protection against both the single 8 Gy dose and the combined dose, though the protective effect was less pronounced with the latter due to the cumulative effects presenting greater challenges. The combined dose offered a more complex model that mimics real-world scenarios of repeated radiation exposure, highlighting the cumulative effects and the need for more robust protective strategies. In conclusion, the combined dose of 6 Gy + 8 Gy increased the sensitivity of mice to subsequent exposures and provided a more challenging model for testing protective agents, which was valuable for understanding radiation sensitivity mechanisms and developing treatments for severe radiation sickness.
Our study showed that Lico B exhibited significant protective effects against radiation-induced damage in cell and animal models through multiple pathways, including reducing DNA damage, exhibiting antioxidant effects, inhibiting inflammation, and regulating ferroptosis. This provides valuable information for further research and development of radioprotective strategies and offers new ideas and methods for protecting humans from radiation damage.
However, despite the positive results of our study, there are still some limitations. First, most of our research was conducted in vitro and in mouse models; further clinical studies are needed to validate these findings. Second, the safety and efficacy of Lico B need further evaluation to ensure its feasibility for clinical application.