Introduction
Nonalcoholic fatty liver disease (NAFLD) is emerging as one of the most prevalent causes of chronic liver disease worldwide.1 NAFLD encompasses a range of conditions, from simple hepatic steatosis to more advanced diseases, such as nonalcoholic steatohepatitis (NASH), fibrosis, cirrhosis, and liver cancer. In NAFLD, lipid accumulation in the liver leads to NASH, which is characterized by progressive liver injury, inflammation, and oxidative stress. Over time, this condition can progress to severe fibrosis and cirrhosis.2,3 The progression of liver fibrosis in NASH is driven by sustained injury to the liver, which activates hepatic stellate cells. When activated by liver injury, these cells differentiate into myofibroblast-like cells, which produce extracellular matrix (ECM) components, including alpha-smooth muscle actin (α-SMA) and type I collagen (Col1a1/Col1a2).4 These cells contribute to the excessive buildup of ECM in liver tissue, promoting fibrogenesis.2,5,6 Another key factor in this process is transforming growth factor-β (TGF-β), which primarily mediates the activation of fibroblasts under fibrotic conditions.7 Given the critical role of TGF-β, targeting the TGF-β signaling pathway is a promising therapeutic strategy for managing liver fibrosis.4 NASH-related liver fibrosis has become a major global health concern, and managing its progression could prevent the subsequent development of liver cirrhosis and cancer.8
Heme oxygenase 1 (HO-1) is a key enzyme in the breakdown of heme. It catalyzes the conversion of heme into carbon monoxide, free iron, and biliverdin, which is further reduced to bilirubin by biliverdin reductase. In addition to its enzymatic function, HO-1 exhibits strong antioxidant and anti-inflammatory properties.9,10 The induction or overexpression of HO-1 can help reduce liver damage in NAFLD mouse models.11 We have previously established a link between HO-1 and NAFLD, demonstrating that high HO-1 levels can alleviate hepatic steatosis and inhibit fibrosis progression. These findings underscore the important role of HO-1 in mitigating liver fibrosis associated with NASH.12,13
Sirtuin 1 (SIRT1) is a histone deacetylase activated by nicotinamide adenine dinucleotide (NAD+). It is essential in various cellular processes, including transcription, apoptosis, stress responses, and metabolism.14,15 Notably, SIRT1 is also a known protective factor against liver fibrosis.16 Furthermore, sirtuins, including SIRT1, exert protective effects against acute liver injuries.17 One of the factors involved in regulating SIRT1’s protective effects on cells is HO-1.18 Moreover, growing evidence suggests that the overexpression or activation of SIRT1 can help slow fibrosis progression.19 Increased SIRT1 expression in the kidneys can reduce the levels of fibrosis markers, such as α-SMA and Colla1, to inhibit renal fibrosis.20 Similarly, activating SIRT1 can enhance survival and reduce pulmonary fibrosis in a bleomycin-induced lung fibrosis mouse model.21 Thus, SIRT1 may inhibit fibrosis in different organs by modulating the TGF-β/Smad signaling pathway.4 Given its potential therapeutic benefits, SIRT1 presents a promising target for addressing metabolic syndrome, diabetes, and other diseases associated with insulin resistance. However, despite these insights, the precise biological functions of SIRT1 in the liver remain unclear and require further investigation.15
Methods
Animals and treatments
Eight-week-old male C57BL/6J wild-type mice were housed in an environmentally controlled facility under a 12-h light/dark cycle with ad libitum access to food and water. The mice were randomly divided into four groups (n = 6) and received group-specific diets for eight weeks: (1) Control group: Mice were fed a normal diet; (2) Methionine- and choline-deficient (MCD) group: Mice were fed an MCD diet (Research Diets, Inc., NJ, New Brunswick, USA); (3) Hemin group: Mice were fed an MCD diet and treated with the HO-1 chemical inducer Hemin three times per week; (4) Zinc protoporphyrin (Znpp) group: Mice were fed an MCD diet and treated with the HO-1 inhibitor Znpp three times per week. At the end of the eight-week period, all animals were fasted overnight and euthanized.22 Blood and liver samples were then collected. Livers were weighed and either fixed in 10% neutral-buffered formalin for histological analysis or rapidly frozen in liquid nitrogen and stored at −80°C for RNA and protein extraction. All procedures were conducted in accordance with the guidelines of the Animal Care and Use Committee of Hebei Province and were approved by the Animal Experiment Ethics Committee of Hebei Medical University.
Histological and biochemical analysis
Liver tissues were fixed in 4% neutral formalin and embedded in paraffin blocks. Hematoxylin-eosin, Masson’s trichrome staining, and Sirius Red staining were used to stain 5 µm thick liver sections. The sum of steatosis, lobular inflammation, and fibrosis was assessed by two expert liver pathologists for NASH assessment using the NAFLD activity score algorithm.23
Western blot analysis
Using RIPA buffer supplemented with PMSF, 20 mg of liver tissue was used for protein extraction. PVDF membranes were used to transfer the proteins separated by SDS-PAGE. After blocking for 1 h in Tris-buffered saline with Tween 20 (TBST) with 5% skim milk or 3% BSA, membranes were incubated with antibodies against reduced glyceraldehyde-3-phosphate dehydrogenase (1:2,000, AB0036, Abways Technology, Shanghai, China); HO-1 (1:2,000, ab189491, Abcam, Cambridge, USA); SIRT1 (1:1,000, ab189494, Abcam, Cambridge, USA); TGF-ß (1:1,000, ab179695, Abcam, Cambridge, USA); phosphorylated Smad2/3 (1:1,000, ab202445, Abcam, Cambridge, USA); Smad2/Smad3 (1:1,000, ab202445, Abcam, Cambridge, USA); α-SMA (1:2,000, CY1132, Abways Technology, Shanghai, China); and Colla1 (1:800, AF7001, Affinity, Jiangsu, China). After incubation, the membrane was washed three times with TBST for 10 m each time. The membrane was then incubated with the secondary antibody DyLight 800 goat IgG (1:7,000, A23920, Abbkine Scientific, Wuhan, China) at 37°C for 1 h. Following incubation, the membrane was washed with TBST three times for 10 m each time. Finally, protein bands were detected using the Odyssey Fluorescence Imaging System (LI-COR, USA) and analyzed for density using ImageJ software (National Institutes of Health, Bethesda, MD, USA).24
Biochemical analysis
The mice were fasted for at least 8 h overnight and then euthanized. Blood samples were collected for serum analysis of alanine aminotransferase (ALT) and aspartate aminotransferase (AST), which were measured using appropriate enzyme assay kits on a dedicated automatic analyzer (Chemray 240, Shanghai, China).
Cell culture
LX-2 cells were cultured in Dulbecco’s Modified Eagle Medium supplemented with 100 U/mL penicillin, 100 µg/mL streptomycin (both from Life Technologies, Gaithersburg, MD, USA), and 10% fetal bovine serum (Wuhan ProNova Life Science, Wuhan, China). Cells were incubated at 37°C in a humidified atmosphere with 5% CO2.
Cell transfection
The six-well plates were applied to incubate LX-2 cells overnight, which were transiently transfected utilizing Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA).24 Small interfering RNAs (siRNAs) designed against HO-1 (hereinafter referred to as SiHO-1), the siRNA control, HO-1 overexpression vector (OE HO-1), and overexpression control were synthesized by GenePharma (Shanghai, China). The siRNA sequences are shown in Supplementary Table 1 and Supplementary Figure 3.
Cell treatment
To establish an in vitro liver fibrosis model, LX-2 cells were stimulated with TGF-β1 (10 ng/mL, Abways Biotechnology, Shanghai, China) for 48 h.25 As previously described,26,27 the cells were treated with the SIRT1 activator SRT1720 (1 µM, HY-10532, MedChemExpress, Shanghai, China) or the inhibitor EX527 (10 µM, HY-15452, MedChemExpress), as shown in Supplementary Figure 1. An HO-1 knockdown model was established by transfecting cells with siRNA (GenePharma), and HO-1 overexpression was induced using the pcDNA3.1 HO-1 plasmid (GenePharma).
Real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR)
Total RNA was isolated from the liver tissue using TRIzol reagent (Invitrogen). First-strand cDNA synthesis was performed using the High-Capacity cDNA Reverse Transcription Kit (Takara Bio, RR036A), according to the manufacturer’s instructions. RT-qPCR was performed on an ABI 7500 Real-Time PCR System (Applied Biosystems, Foster, CA, USA), using TBGreen™ Premix Ex Taq™ II (Tli RNaseH Plus; Takara Bio, RR820A), as previously described.28 The primers used for RT-PCR are listed in Table 1. Glyceraldehyde-3-phosphate dehydrogenase expression was used as an internal control. Relative RNA expression levels were calculated using the 2−ΔΔCt method.
Table 1The primer sequences (mus)
| Gene name | Primer sequences (5′-3′) |
|---|
| GAPDH | F:CAAGAAGGTGGTGAAGCAGG
R:AAAGGTGGAGGAGTGGGTGT |
| HO-1 | F: AAGCCGAGAATGCTGAGTTCA
R: GCCGTGTAGATATGGTACAAGGA |
| SIRT1 | F: TGATTGGCACCGATCCTCG
R: CCACAGCGTCATATCATCCAG |
| TGFβ1 | F: CTCCCGTGGCTTCTAGTGC
R: GCCTTAGTTTGGACAGGATCTG |
| Smad3 | F: CATTCCATTCCCGAGAACACTAA
R: GCTGTGGTTCATCTGGTGGT |
| α-SMA | F: GTACCACCATGTACCCAGGC
R: GCTGGAAGGTAGACAGCGAA |
| COL1A1 | F: TTCTCCTGGCAAAGACGGAC
R: CGGCCACCATCTTGAGACTT |
Immunofluorescence
As previously described,29 LX-2 cells subjected to various treatments were fixed with cold methanol for 5 m. Subsequently, the cells were washed three times with PBS, followed by permeabilization with 0.1% Triton for 10 m. After culturing with 3% bovine serum albumin for 30 m, the cells were immediately incubated with the primary antibody at 4°C overnight. Then, the cells were incubated with the secondary antibody at room temperature for 1 h and washed with PBS three times. 4′,6-Diamidino-2-phenylindole staining was performed, and the slide was sealed. Images were captured under a fluorescence microscope. Statistical analysis was performed using ImageJ image analysis software.
Flow cytometry
The cells were first treated with 1× Annexin V Binding Buffer (100 µL) for 10 m, then 2.5 µL of Annexin V-FITC Reagent and 2.5 µL of Phosphorus Incorporation Reagent (50 µg/mL) were added. The samples were gently vortexed and incubated at room temperature in the dark for 15–20 m. 1× Annexin V Binding Buffer (400 µL) was added to the samples and mixed well. The cell-cycle phase distribution and apoptosis were determined using a BD AccuriTM C6 flow cytometer (BD Biosciences, USA).30
Terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) staining assay
The TUNEL apoptosis assay was performed using a TUNEL Apoptosis Assay Kit (Biyuntian, China), according to the manufacturer’s instructions, as previously described.28 As per the experimental requirements, the adherent cells were fixed with 4% paraformaldehyde for 30 m, followed by incubation with TUNEL solution for 1 h. The cells were then stained with 4′,6-Diamidino-2-phenylindole in the dark for 10 min. Fluorescent images were captured using a fluorescence microscope (Olympus, Japan) from at least three randomly selected fields. Apoptosis was analyzed using ImageJ software.
Cell Counting Kit-8 (CCK-8) Assay
For each treatment group, 9 × 105 cells were suspended in 3 mL of Complete Cell Culture Medium. Each group of cells was seeded at a density of 100 µL cell suspension per well in a 96-well plate. The cells were cultured for 0, 12, 24, 36, 48, and 72 h. 10 µL of CCK-8 reagent (Beijing Solarbio Technology Co., Ltd.) was added to each well, and the plate was incubated for 1.5 h. The absorbance was measured at 450 nm using an enzyme-linked immunosorbent assay kit (Infinite F50, Swiss TECAN Company).31
Reactive Oxygen Species (ROS) Assay Kit
The ROS in the cells were measured using a ROS detection kit (Beijing Solarbio Technology Co., Ltd.). 2 µL of the red fluorescent probe stock solution was added to the cell suspension, and the cells were incubated in the dark at room temperature for 30 m. Then, the cells were centrifuged at 250–500 g for 5 m to remove the staining solution and washed twice with PBS. The analysis was performed using a flow cytometer (Beckman Coulter, USA).32
Statistical analysis
The statistics were analyzed utilizing GraphPad Prism v8.0 software (GraphPad, San Diego, CA, USA). Intergroup comparison was conducted using one-way analysis of variance with Student’s t-test. Data are presented as mean ± standard deviation. Statistical significance was indicated by a p-value of <0.05.
Results
HO-1 alleviates inflammation and fibrosis in MCD diet-induced NAFLD mice
The results of Hematoxylin-eosin, Masson’s trichrome staining, and Sirius Red staining indicated that mice fed the MCD diet for eight weeks displayed signs of fatty degeneration, disruption of lobular architecture, inflammatory infiltration, and pericellular fibrosis. Treatment with hemin significantly reduced the severity of these liver abnormalities, whereas treatment with the HO-1 inhibitor Znpp exacerbated these conditions (Fig. 1E–H). Moreover, biochemical analysis showed that, compared with control mice, mice treated with hemin had significantly lower serum ALT and AST levels. In contrast, treatment with Znpp further elevated serum transaminase levels (Fig. 1C and D). Mice on the MCD diet also exhibited reduced body weight compared with the control group. Znpp treatment further decreased both body weight and the liver-to-body weight ratio. However, HO-1 induction increased both parameters (Fig. 1A and B). Overall, these findings indicate that HO-1 induction mitigated liver injury and fibrosis associated with MCD diet-induced steatohepatitis.
HO-1 regulates the SIRT1/TGF-ß/Smad3 pathway in NAFLD-associated liver fibrosis
Findings from RT-qPCR analysis demonstrated that, compared with the control group, SIRT1 mRNA expression was significantly lower in MCD mice. Treatment with Znpp further reduced SIRT1 expression, whereas hemin increased it (Fig. 2A–F). To explore the relationship between HO-1 and SIRT1, we performed immunofluorescence double-labeling, which revealed the targeted interaction between these two proteins (Fig. 2G). In the MCD diet-fed mice, this interaction was weaker than that in the control group, while inducing HO-1 enhanced the binding between HO-1 and SIRT1 (Fig. 2H–K). To further investigate the effects of HO-1 on NAFLD-related liver fibrosis via the SIRT1/TGF-ß/Smad3 signaling pathway, we manipulated HO-1 levels (induction or inhibition), and Western blot analysis measured the protein expression of key pathway components (Fig. 3A–I). As expected, in the MCD diet-fed mice, SIRT1 protein levels were lower than those in the control group. This decrease was also observed in the group treated with Znpp. Conversely, treatment with hemin significantly increased SIRT1 protein levels compared with the MCD diet group. In contrast to the changes observed in SIRT1 expression, TGF-ß and P-Smad2/3 protein levels increased in MCD diet-fed mice, which were further increased by Znpp treatment. Overall, these results demonstrate that HO-1 regulates NAFLD-related liver fibrosis by modulating the SIRT1/TGF-ß/Smad3 pathway.
HO-1 mediates liver inflammation and fibrosis in vitro
To further explore how HO-1 regulates NAFLD-related liver fibrosis through the SIRT1/TGF-ß/Smad3 pathway, we developed an in vitro hepatic fibrosis model by stimulating LX-2 cells with TGF-ß. Confirmation of HO-1 knockdown and HO-1 overexpression in LX-2 cells by both qPCR and Western blotting is shown in Supplementary Figure 2, and the siRNA sequences are shown in Supplementary Table 2. The successful knockdown and overexpression of HO-1 in LX-2 cells were verified by Western blot analysis (Fig. 4A–B). As shown in the figure, the expression levels of α-SMA and Colla1 were significantly elevated in the TGF-ß-treated group compared with the control. Notably, in the SiHO-1 group, these markers were further increased relative to the TGF-ß group, whereas in the OE HO-1 group, a decrease in α-SMA and Colla1 expression was observed in LX-2 cells (Fig. 4K–L). Immunofluorescence was also used to validate these results, and we found that overexpression of HO-1 or treatment with SRT1720 both inhibited fibrosis progression. Furthermore, we observed that SIRT1 activation counteracted the anti-fibrotic effect of HO-1 silencing (Fig. 5D–E).
Downregulation of SIRT1 expression in TGF-ß-stimulated LX-2 cells
Given that sustained TGF-ß activation is a key feature of fibrosis, we explored its potential role in regulating SIRT1 expression. As shown in the figure, Western blot analysis revealed that exposure of LX-2 cells to TGF-ß reduced SIRT1 levels. In contrast, treatment with the SIRT1 activator SRT1720 in these TGF-ß-stimulated cells increased SIRT1 expression. In contrast, inhibiting SIRT1 further decreased its expression in TGF-ß-stimulated LX-2 cells (Fig. 4C–D). Moreover, immunofluorescence analysis confirmed that activation of SIRT1 inhibited the pro-fibrotic effects of TGF-ß, including the differentiation of quiescent fibroblasts into myofibroblasts (Fig. 5A–C).
HO-1 regulates NAFLD-related liver fibrosis in vitro through the SIRT1/TGF-ß/ Smad3 pathway
To further investigate the regulation by HO-1 of NAFLD-related liver fibrosis, we analyzed the expression of proteins involved in the SIRT1 signaling pathway by Western blot (Fig. 4E–I). Our results revealed that HO-1 knockdown reduced SIRT1 expression in TGF-ß-stimulated LX-2 cells while simultaneously increasing TGF-ß and P-Smad2/3 levels. Compared with the control group, the TGF-ß group exhibited significantly lower SIRT1 expression and higher P-Smad2/3 levels. Conversely, the OE HO-1 increased SIRT1 expression and reduced TGF-ß and P-Smad2/3 levels. To determine whether SIRT1 influences the antifibrotic effects of HO-1, we treated cells with the SIRT1 inhibitor EX527. This treatment significantly reversed the inhibitory effects of HO-1 on the TGF-ß/Smad3 signaling pathway and liver fibrosis in vitro. Taken together, these findings demonstrate that HO-1 regulates NAFLD-related liver fibrosis through the SIRT1/TGF-ß/Smad3 pathway.
Effects of HO-1 and SIRT1 on the biological behavior of LX-2 cells
We further explored the potential impact of HO-1 and SIRT1 on the biological behavior of LX-2 cells through a series of experiments. Cell proliferation was assessed using the CCK-8 assay (Fig. 6C). TGF-ß stimulation significantly promoted LX-2 cell proliferation compared with the control group. Overexpression of HO-1 or treatment with SRT1720 suppressed LX-2 cell proliferation. In contrast, silencing HO-1 or inhibiting SIRT1 notably enhanced cell proliferation. Furthermore, we observed that SIRT1 activation counteracted the proliferative effect induced by HO-1 silencing. These findings are consistent with previous studies on the roles of HO-1 and SIRT1 in cell growth. We also assessed apoptosis using flow cytometry in the same experimental groups. The results revealed that, similar to the proliferation assay, TGF-ß stimulation reduced LX-2 cell apoptosis compared with the control group. Overexpression of HO-1 or treatment with SRT1720 enhanced LX-2 apoptosis, whereas silencing HO-1 or inhibiting SIRT1 significantly decreased apoptosis (Fig. 6A–B). Additionally, TUNEL staining was performed to further validate these apoptosis findings (Fig. 7A–D). These observations confirm that both HO-1 and SIRT1 are integral in regulating LX-2 cell behavior, and their modulation affects both cell proliferation and apoptosis.
Effects of induced HO-1 and SIRT1 on extracellular ROS in the liver in vitro
In the progression of NAFLD, sustained oxidative stress disrupts the balance between ROS and the antioxidant capacity of hepatocytes, resulting in lipid peroxidation. Our previous studies15 have shown that HO-1 plays a crucial role in NASH-related liver fibrosis and may serve as an antioxidant mediator under stress conditions in NASH. In damaged hepatocytes, the induction of HO-1 may trigger an adaptive stress response, potentially acting as a defense mechanism against oxidative stress and protecting hepatocytes from oxidative damage. Our previous studies also showed that overexpression of HO-1, achieved by injecting hemin into mice, significantly attenuates the severity of steatohepatitis and alleviates the overproduction of ROS.14 Further evidence from other studies demonstrated that knockdown of HO-1 increases ROS levels.33 Similarly, SIRT1, a NAD+-dependent deacetylase, regulates gene expression through histone deacetylation. Elevated ROS levels can suppress SIRT1 activity through oxidative modification of its cysteine residues. SIRT1 is a NAD+-dependent protein deacetylase that reduces ROS levels and is involved in cell survival under oxidative stress conditions. Studies have shown that SIRT1 deficiency in tissues such as the liver, pancreas, and brain significantly increases ROS levels and inflammatory responses.34 Mitochondrial ROS significantly affect the development of NAFLD. To explore the influence of HO-1 and SIRT1 on ROS production in NAFLD-related liver fibrosis, we measured ROS levels in LX-2 cells by flow cytometry. As illustrated in the figure, ROS levels were significantly elevated in the TGF-ß stimulation group compared with the control group. However, overexpression of HO-1 or treatment with SIRT1 activators effectively reduced ROS levels. In contrast, silencing HO-1 or inhibiting SIRT1 significantly promoted ROS production (Fig. 6D–E).
Discussion
As NAFLD progresses, persistent oxidative stress disrupts the balance of oxidative processes, ultimately damaging cellular organelles.35 HO-1 acts as an antioxidant mediator, protecting against NAFLD-associated liver fibrosis. In this study, we demonstrated that inhibiting HO-1 in LX-2 cells, when stimulated with TGF-ß, led to enhanced ROS production, as revealed by flow cytometry assays, compared with cells treated with TGF-ß alone. Mechanistically, our findings show that HO-1 mitigates NAFLD-related liver fibrosis through the SIRT1/TGF-ß/Smad3 signaling pathway. RT-qPCR and Western blot analysis revealed that HO-1 expression was upregulated in mice fed an MCD diet. Biochemical analysis revealed an elevation in ALT and AST levels in this group. However, in mice treated with hemin, ALT and AST levels were significantly reduced, indicating improved liver function. In contrast, treatment with Znpp increased ALT and AST levels, indicating intensified liver injury compared with the MCD diet alone. Consistent with this, compounds such as hemin (which induces HO-1 expression) and Znpp (which inhibits it) can modulate heme metabolism and influence liver injury and fibrosis progression.36 Based on these findings, we further explored the role of HO-1 in liver fibrosis associated with NAFLD and its potential targets.
SIRT1 activators can mitigate fibrosis by inhibiting the TGF-ß/Smad3 signaling pathway.37 However, the potential role of HO-1 in modulating the SIRT1/TGF-ß/Smad3 axis to alleviate NAFLD-related liver fibrosis, both in vitro and in vivo, is a novel area of research. SIRT1 plays a crucial role in various liver diseases, including alcoholic liver disease, NAFLD, and hepatocellular carcinoma.37–40 Intervening in SIRT1 expression and activity presents a promising therapeutic approach for managing liver fibrosis associated with NAFLD. In our animal model, we used immunofluorescence double-labeling to show that HO-1 targets SIRT1. We observed that the interaction between HO-1 and SIRT1 was enhanced in the hemin-treated group but significantly reduced by Znpp treatment. Western blotting further confirmed that hepatic SIRT1 expression is closely linked to HO-1 activity. Specifically, SIRT1 protein levels increased when HO-1 was overexpressed in the hemin-treated group. Other studies have supported the SIRT1-dependent beneficial effects of HO-1, as demonstrated by experiments involving the overexpression of the SIRT1 plasmid and siRNA silencing.12 In line with these findings, Boily et al.41 reported that SIRT1 knockout mice exhibit increased metabolic activity, impaired hepatic mitochondrial function, and enhanced lipid oxidation rates. Moreover, SIRT1 not only slows the progression of liver fibrosis by promoting cell apoptosis and reversing the activation of stellate cells but also delays the aging process by regulating inflammation-related pathways. Furthermore, SIRT1 can inhibit TGF-β-induced collagen production and myofibroblast differentiation in pulmonary fibrosis.42 TGF-β is a potent fibrotic stimulant that activates stellate cells through the TGF-β/Smad3 signaling pathway.43–45 When TGF-β binds to its receptor, TGF-βR, it induces the phosphorylation of downstream Smad2 and Smad3. These activated Smads form a complex with Smad4, which then translocates to the nucleus to promote the transcription of ECM-related components.46 This process leads to the upregulation of genes associated with ECM formation, including TGFβR, SMAD2/3, COL1A1, and ACTA2.45 Our study confirmed the activation of the TGF-β/Smad3 pathway in liver fibrosis, which aligns with previous findings. Furthermore, we performed RT-qPCR, Western blot, and immunofluorescence experiments and observed that SIRT1 inhibited liver fibrosis onset and progression. Importantly, an inverse relationship was observed between SIRT1, TGF-β, and Smad3, indicating that SIRT1 alleviated liver fibrosis by modulating the TGF-β/Smad3 signaling pathway. We conducted in vitro experiments to further investigate the molecular mechanisms through which HO-1 influences the TGF-β/Smad3 pathway via SIRT1. In our study, we investigated the effects of SIRT1 modulation in LX-2 cells. After treatment with EX527 at a concentration of 10 µM, RT-qPCR and Western blot analysis revealed that both SIRT1 mRNA and protein levels were significantly reduced in LX-2 cells. Immunofluorescence analysis revealed a notable increase in α-SMA expression, a marker of fibrosis. In contrast, when we treated LX-2 cells with 1 µM of SRT1720, the lowest nontoxic concentration, RT-qPCR and Western blot analysis revealed that both SIRT1 mRNA and protein levels significantly increased. Building on this, we then inhibited SIRT1 using EX527 in cells overexpressing HO-1. This intervention reversed the reduction in gene expression in the TGF-β/Smad3 signaling pathway previously observed with HO-1 overexpression, thereby worsening liver fibrosis. Conversely, when we silenced HO-1 and activated SIRT1 with SRT1720, the downregulation of genes in the TGF-β/Smad3 pathway induced by HO-1 silencing was mitigated. Our results indicate that HO-1 regulates the TGF-β/Smad3 pathway through SIRT1, thereby mitigating liver fibrosis. Furthermore, we evaluated the effects of HO-1 and SIRT1 levels on apoptosis in LX-2 cells through flow cytometry analysis. We found that both HO-1 and SIRT1 expression promoted cell apoptosis, suggesting a protective role in the pathogenesis of liver fibrosis related to NAFLD, primarily by enhancing the apoptosis of hepatic stellate cells. Our previous clinical investigations suggested that HO-1 might serve as a potential diagnostic biomarker, and the activation of HO-1 could be a therapeutic approach for NAFLD or fibrotic NASH. Studies have shown that serum levels of HO-1 are significantly higher in NAFLD patients compared to healthy controls. Further analysis using ROC curves demonstrated that HO-1 is a potential diagnostic biomarker for NAFLD, with an exceptionally high sensitivity of 98.82%. Thus, HO-1 could serve as an important complementary biomarker in the molecular diagnostic framework for NAFLD.47 Furthermore, in another study involving 30 patients with liver biopsy-proven NASH and 15 healthy controls, we confirmed by IHC and RT-qPCR that HO-1 can effectively inhibit the onset of endoplasmic reticulum stress. These results indicated that HO-1 may serve as a therapeutic target for personalized treatment strategies in NASH.48 Our experiments support these findings, as overexpression of HO-1 via plasmid transfection reduced hepatic fat accumulation and inflammation, thereby alleviating the progression of NAFLD.
SIRT1, a multifunctional protein involved in regulating liver lipid metabolism, plays a pivotal role in the development of NAFLD by deacetylating various target proteins. It has been reported that SIRT1 expression is decreased in the livers of NAFLD patients compared to healthy individuals. Additionally, hepatic SIRT1 mRNA levels have been found to be inversely correlated with the severity of hepatic steatosis and portal fibrosis. SIRT1 levels also exhibit a negative correlation with body mass index, the HOMA index, serum glucose, and ALT levels.17 Our experimental findings, both in vitro and in vivo, show a similar downregulation of SIRT1 expression in NAFLD. These findings highlight its potential as a therapeutic target for the treatment of non-alcoholic fatty liver disease.
Therefore, targeting HO-1 and SIRT1 for therapeutic intervention in NAFLD may be a promising strategy. While current research primarily focuses on animal and in vitro studies, ongoing advancements suggest that HO-1 and SIRT1 activators could emerge as therapeutic options for the treatment of NAFLD and its complications. These findings pave the way for potential clinical applications.
Conclusions
The results of this study demonstrate that HO-1 helps reduce hepatic fibrosis associated with NAFLD by modulating the SIRT1/TGF-β/Smad3 signaling pathway. Insights into the interactions between HO-1 and SIRT1 in NAFLD-associated liver fibrosis could facilitate the development of new biomarkers and treatment strategies for liver dysfunction. Ultimately, this deeper understanding could lead to improved quality of life and life expectancy for patients suffering from NAFLD-related hepatic fibrosis.
Supporting information
Supplementary Table 1
Sequences.
(DOCX)
Supplementary Table 2
The siRNA sequences and concentrations in LX2 cells.
(DOCX)
Supplementary Fig. 1
The expression levels of LINC00886.
(A and B) LINC00886 expression was analyzed using qRT-PCR after transfection of Hep3B and Huh7 cells with Si-NC, Si-LINC00886, pcDNA3.1 or pcDNA3.1-LINC00886, respectively. ****P<0.0001.
(DOCX)
Supplementary Fig. 2
The expression levels of RAB10 and E2F2.
(A and B) qRT-PCR was utilized to evaluate RAB10 (A) and E2F2 expression (B) after transfection of Hep3B and Huh7 cells with miR-NCs, miR-409-3p/miR-214-5p mimics, and miR-409-3p/miR-214-5p inhibitors, respectively. Relative RAB10 and E2F2 expression levels were detected utilizing qRT-PCR in PBMC samples (C, n=20 per group). qRT-PCR and Western blotting were utilized to access the mRNA and protein levels of RAB10 and E2F2 in hepatic tissues (D and E, n=5 per group) and HCC cells (F and G). (H and I) qRT-PCR was utilized to access RAB10 and E2F2 expression following HCC cell transfection of Si-NC, Si-LINC00886, pcDNA3.1 or pcDNA3.1-LINC00886, respectively. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. HCC, hepatocellular carcinoma; LC, liver cirrhosis; PBMC, peripheral blood mononuclear cell; qRT-PCR, quantitative reverse-transcriptase polymerase chain reaction.
(DOCX)
Supplementary Fig. 3
The expression levels of miR-409-3p, miR-214-5p, RAB10 and E2F2.
Relative miR-409-3p expression levels were detected utilizing qRT-PCR in hepatic tissues (A, n=5 per group), PBMC samples (B, n=20 per group) and. HCC cells (C). (D) qRT-PCR was utilized to analyze RAB10 after introduction of Si-LINC00886+miR-NC, pcDNA3.1-LINC00886+miR-NC, Si-LINC00886+miR-409-3p inhibitors or pcDNA3.1-LINC00886+miR-409-3p mimics into HCC cells. Relative miR-214-5p expression levels were detected utilizing qRT-PCR in hepatic tissues (E, n=5 per group), PBMC samples (F, n=20 per group) and. HCC cells (G). (H) qRT-PCR was utilized to analyze E2F2 after introduction of Si-LINC00886+miR-NC, pcDNA3.1-LINC00886+miR-NC, Si-LINC00886+ miR-214-5p inhibitors or pcDNA3.1-LINC00886+ miR-214-5p mimics into HCC cells. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. HCC, hepatocellular carcinoma; LC, liver cirrhosis; PBMC, peripheral blood mononuclear cell; qRT-PCR, quantitative reverse-transcriptase polymerase chain reaction.
(DOCX)
Declarations
Ethical statement
The research protocol was approved and supervised by the Ethics Committee of the Third Hospital of Hebei Medical University (approval number: 2021-0851). All animals received human care.
Data sharing statement
The data used to support the findings of this study are included within the supplementary information file(s).
Funding
This study was supported by the National Natural Science Foundation of China (Grant No. 81970504), the Natural Science Foundation of Hebei Province (Grant No. H2018206326), the Key Research and Development Program of Hebei Province (Grant No. 19277779D), the Medical Talents Program of Hebei Province (2021), and the Fourth Batch of Top-talents of Hebei Province.
Conflict of interest
YN has been an Editorial Board Member of Journal of Clinical and Translational Hepatology since 2022. The other authors have no conflict of interests related to this publication.
Authors’ contributions
Study concept and design (MS), analysis and interpretation of data (XW, ZL, CZ), performing the experiments (MS, JC, YM), manuscript preparation (MS, YS, JZ), and critical revision of the manuscript for important intellectual content (YN). All authors made significant contributions to this study and approved the final manuscript.